D8Mit51 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D8Mit51

Symbol: D8Mit51
Also known as: B539; 
RGD ID: 4930131
Expected Size: 213 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38888,396,181 - 88,396,393UniSTSGRCm38
MGSCv37890,920,080 - 90,920,292UniSTSGRCm37
Celera892,670,731 - 92,670,939UniSTS
Cytogenetic Map8C3UniSTS
cM Map841.0UniSTS
Whitehead Genetic841.5UniSTS
Whitehead_YAC8 UniSTS
Is Marker For: Genes:   Gm2738  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTCGACATTGTGTGAGATTCC
Reverse Primer ATGAAACATATGTGAGAATGTCCA
 

Region

Nucleotide Sequences
GenBank Nucleotide AC112258 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL592564 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4141395Char2a_mP. chabaudi malaria resistance QTL 2a (mouse)Not determined7113678390202598Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1300920Pitm3_mprion incubation time 3 (mouse)Not determined873202495107202598Mouse
27095912Pglq14_mpelvic girdle length QTL 14, 16 week (mouse)873400000126100000Mouse
1558890Lith18_mlithogenic gene 18 (mouse)Not determined875675517109675623Mouse
1357470Obq16_mobesity QTL 16 (mouse)Not determined875685348109685497Mouse
1301808Nhdlq1_mnon-HDL QTL 1 (mouse)Not determined875685348109685497Mouse
1301874Hdlq16_mHDL QTL 16 (mouse)Not determined875685348109685497Mouse
10412234Nhdlq14_mnon-HDL QTL 14 (mouse)Not determined875685348109685497Mouse
1301099Cbm2_mcerebellum weight 2 (mouse)Not determined878518613112518703Mouse
1301581Char2_mP. chabaudi malaria resistance QTL 2 (mouse)Not determined879082178113082403Mouse
12904012Cfq10_mconditioned fear QTL 10 (mouse)88006677589014359Mouse
10755530Wbc2_mwhite blood cell count 2 (mouse)881092664115092664Mouse
10755519Wbc1_mwhite blood cell count 1 (mouse)881619151115619151Mouse
1301766Desp1_mdespair 1 (mouse)Not determined884759576118759741Mouse
1302049Heal1_mwound healing/regeneration 1 (mouse)Not determined885716921119717069Mouse
1301253Skmw2_mskeletal muscle weight 2 (mouse)Not determined885716921119717069Mouse
10045619Heal14_mwound healing/regeneration 14 (mouse)Not determined885716921119717069Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:702240 UniSTS
NCBI Gene 100040369 UniSTS
  492884 UniSTS
UniSTS 131594 UniSTS