D16Mit202 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D16Mit202

Symbol: D16Mit202
Also known as: ND; MTH1240; 
RGD ID: 4922791
Expected Size: 190 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381673,127,308 - 73,127,497UniSTSGRCm38
MGSCv371673,127,553 - 73,127,742UniSTSGRCm37
Celera1673,388,448 - 73,388,637UniSTS
cM Map1647.3UniSTS
Whitehead Genetic1635.0UniSTS
Whitehead/MRC_RH16807.02UniSTS
Whitehead_YAC16 UniSTS


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTAGGATTAGAAGGAGCATAGGACA
Reverse Primer CTTGTTATAAGAGAAAGGAAAGAGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
16096904930500H12RikRIKEN cDNA 4930500H12 gene167307234673410430Mouse

Nucleotide Sequences
GenBank Nucleotide AC140206 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
26884376Skwq4_mskull length QTL 4, 5 week (mouse)16860000091100000Mouse
1357517Bwtn1_mbody weight at necropsy 1 (mouse)Not determined162020057985803938Mouse
1302096Aod1a_mautoimmune ovarian dysgenesis 1a (mouse)Not determined163562627392776120Mouse
26884416Bzwq5_mbi-zygomatic width QTL 5, 5 week (mouse)163750000084900000Mouse
4142112Skts-fp3_mskin tumor susceptibility in FVB and PWK 3 (mouse)Not determined164023351973127497Mouse
11522747Eae41_mexperimental allergic encephalomyelitis susceptibility 41 (mouse)164057877278218584Mouse
1301138Pcd4ts3_mp-glycoprotein positive CD4 T cell subset 3 (mouse)Not determined164077356074773713Mouse
1357778Diobq_mdiet-induced obesity QTL (mouse)Not determined164237745482534286Mouse
1301719Remslp3_mrapid eye movement sleep 3 (mouse)Not determined164456298778563143Mouse
4141212Imraq3_mimmune response to AAV2 QTL 3 (mouse)Not determined164456298778563143Mouse
10053677Eae46_mexperimental allergic encephalomyelitis susceptibility 46 (mouse)Not determined164539769878952955Mouse
14928310Manh80_mmandible shape 80 (mouse)164842295582422955Mouse
1301394Eae11_msusceptibility to experimental allergic encephalomyelitis 11 (mouse)Not determined165376500387765147Mouse
1301364Lith14_mlithogenic gene 14 (mouse)Not determined165586495889865073Mouse
1301125Sluc27_msusceptibility to lung cancer 27 (mouse)Not determined166181175695811876Mouse
4141113Tgq28_mtriglyceride QTL 28 (mouse)Not determined6318975897189758Mouse
1300928Etia_methanol induced activation (mouse)Not determined166351701997517128Mouse
1558740Bpq9_mblood pressure QTL 9 (mouse)Not determined166353044897530584Mouse
1302194Pgia10_mproteoglycan induced arthritis 10 (mouse)Not determined166880383498207768Mouse
1301032Tauph_mtau phosphorylation (mouse)Not determined166927924498207768Mouse
4142262Lmr18_mleishmaniasis resistance 18 (mouse)Not determined166933072398207768Mouse
11049573Lmr18b_mleishmaniasis resistance 18b (mouse)166933072398207768Mouse
11049574Lmr18a_mleishmaniasis resistance 18a (mouse)166933072398207768Mouse
11522753Cocia19_mcocaine-induced activity, QTL 19 (mouse)166945759498207768Mouse
1301598Renf2_mrenal failure 2 (mouse)Not determined167058336498207768Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:706714 UniSTS
NCBI Gene 62980 UniSTS
UniSTS 127839 UniSTS