D15Mit11 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D15Mit11

Symbol: D15Mit11
Also known as: ND; M237; 
RGD ID: 4922062
Expected Size: 99 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38159,705,772 - 9,705,870UniSTSGRCm38
MGSCv37159,635,527 - 9,635,625UniSTSGRCm37
Celera159,505,068 - 9,505,166UniSTS
Cytogenetic Map15A1UniSTS
cM Map1510.4UniSTS
Whitehead Genetic155.5UniSTS
Whitehead/MRC_RH15100.36UniSTS
Whitehead_YAC15 UniSTS
Is Marker For: Genes:   Spef2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TGTGAGAAAAATGACAGTAAGGC
Reverse Primer TCACAGAAAGACAAGACAAAAGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1553027Spef2sperm flagellar 21595781939748868Mouse

Nucleotide Sequences
GenBank Nucleotide AC133586 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  GL590437 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300953Bdt5_mbone density traits 5 (mouse)Not determined15120460347Mouse
1301023Sluc24_msusceptibility to lung cancer 24 (mouse)Not determined15120460347Mouse
1302121Cliff_mcliff drop aversion (mouse)Not determined15120460347Mouse
1301662Faq8_mfluctuating asymmetry QTL 8 (mouse)Not determined15120460347Mouse
5491193Mobq4_mmultigenic obesity QTL 4 (mouse)Not determined15120460347Mouse
4141541Tglq3_mtriglyceride QTL 3 (mouse)Not determined15120460347Mouse
1357459Nhdlq7_mnon-HDL QTL 7 (mouse)Not determined15120460347Mouse
11062069Bpq31_mblood pressure QTL 31 (mouse)15126273109Mouse
4141446Ffaq4_mfree fatty acid QTL 4 (mouse)Not determined127101304Mouse
1300594Eae2_msusceptibility to experimental allergic encephalomyelitis 2 (mouse)Not determined15131218650Mouse
1301136Pgia8_mproteoglycan induced arthritis 8 (mouse)Not determined15321068524388090Mouse
10401902Sicd2_mseizure-induced cell death 2 (mouse)Not determined15344490771325689Mouse
4141952W3q7_mweight 3 weeks QTL 7 (mouse)Not determined346021278717086Mouse
4142448Tailq6_mtail length QTL 6 (mouse)Not determined346021278717086Mouse
4142252Tailaq4_mtail length adjusted QTL 4 (mouse)Not determined346021278717086Mouse
1357559Scfq2_msubcutaneous fat pad weight QTL 2 (mouse)Not determined15346021278717086Mouse
1357659Epfpq4_mepididymal fat percentage QTL 4 (mouse)Not determined15346021278717086Mouse
4141358Ath22_matherosclerosis 22 (mouse)Not determined346456637464566Mouse
11252136Modvl4_mmodifier of vacuolated lens (mouse)15562040839620528Mouse
26884409Bzwq16_mbi-zygomatic width QTL 16, 16 week (mouse)15610000038000000Mouse
26884384Skwq12_mskull length QTL 12, 16 week (mouse)15610000050900000Mouse
26884387Skwq8_mskull length QTL 8, 10 week (mouse)15610000068400000Mouse
26884412Bzwq10_mbi-zygomatic width QTL 10, 10 week (mouse)15610000071600000Mouse
26884417Bzwq4_mbi-zygomatic width QTL 4, 5 week (mouse)15610000072600000Mouse
27226786Feml11_mfemur length 11, 5 week (mouse)15610000076000000Mouse
27095932Ulnl11_mulna length 11, 16 week (mouse)15610000076500000Mouse
27226717Tibw4_mtibia width 4, proximal, 10 week (mouse)15610000078800000Mouse
27226734Tibmd5_mtibia midshaft diameter 5, 10 week (mouse)15610000086800000Mouse
26884442Sklq6_mskull length QTL 6, 5 week (mouse)156100000100900000Mouse
26884429Zlq6_mzygomatic length QTL 6, 10 week (mouse)15680000045100000Mouse
27226721Tibw8_mtibia width 8, proximal, 16 week (mouse)15690000076000000Mouse
27226773Tibl16_mtibia length 16, 10 week (mouse)15690000076000000Mouse
27226777Tibl8_mtibia length 8, 5 week (mouse)15690000084700000Mouse
27095940Ulnl8_mulna length 8, 10 week (mouse)15720000055400000Mouse
27226759Feml17_mfemur length 17, 10 week (mouse)15760000055400000Mouse
27226755Feml22_mfemur length 22, 16 week (mouse)15760000059400000Mouse
27095922Pglq11_mpelvic girdle length QTL 11, 10 week (mouse)15810000038900000Mouse
26884439Sklq11_mskull length QTL 11, 10 week (mouse)15810000047800000Mouse
4140994Shali3_msurvival time to hyperoxic acute lung injury 3 (mouse)Not determined927293643448484Mouse
10412172Habiir5_mhyperoxic acute lung injury imprinted region 5 (mouse)Not determined15927293643448484Mouse
4141192Ssrq2_mstress response QTL 2 (mouse)Not determined927293656323454Mouse
1301433Rapop5_mradiation-induced apoptosis 5 (mouse)Not determined15927293679590561Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:706879 UniSTS
NCBI Gene 320277 UniSTS
  62178 UniSTS
UniSTS 127468 UniSTS