D11Mit321 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D11Mit321

Symbol: D11Mit321
Also known as: ND; MTH990; 
RGD ID: 4920228
Expected Size: 198 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381176,098,373 - 76,098,570UniSTSGRCm38
MGSCv371175,911,875 - 75,912,072UniSTSGRCm37
Celera1183,607,422 - 83,607,619UniSTS
Cytogenetic Map11B4UniSTS
cM Map1143.0UniSTS
Whitehead Genetic1139.3UniSTS
Whitehead/MRC_RH11938.1UniSTS
Whitehead_YAC11 UniSTS
Is Marker For: Genes:   Vps53  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TCTGTTTCTTCTAGGTTAACACAGATG
Reverse Primer GTTAACTACACTGTGTGCTCAGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1322829Vps53VPS53 GARP complex subunit117604622676179638Mouse

Nucleotide Sequences
GenBank Nucleotide AL591129 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse
1301987Pid3_mprior incubation determinant 3 (mouse)Not determined116179599488808902Mouse
1301319Dautb4_mdopamine uptake transporter binding 4 (mouse)Not determined116226517996265327Mouse
27226730Tibmd1_mtibia midshaft diameter 1, 5 week (mouse)1162700000109500000Mouse
1301999Lmr15_mleishmaniasis resistance 15 (mouse)Not determined116342858181939647Mouse
10044004Stzid3_mstreptozotocin induced diabetes susceptibility 3 (mouse)Not determined116342858194173092Mouse
11039501Ltpr6a_mLeishmania tropica response 6a (mouse)116493951098939647Mouse
11039502Ltpr6b_mLeishmania tropica response 6b (mouse)116493951098939647Mouse
11039515Ltpr6_mLeishmania tropica response 6 (mouse)116493951098939647Mouse
1301546Pcir2_mperiosteal circumference 2 (mouse)Not determined1166842594100842826Mouse
1357766Si5lq6_mserum IGFBP-5 level QTL 6 (mouse)Not determined1166842594100842826Mouse
4141012Femwf6_mfemur work to failure 6 (mouse)Not determined66842594100842826Mouse
1301833Tbbmd5_mtotal body bone mineral density 5 (mouse)Not determined1166842594100842826Mouse
1300784Prdt3_mprion disease incubation time 3 (mouse)Not determined1166842594100842826Mouse
1300628Lgth6_mbody length 6 (mouse)Not determined1166842594100842826Mouse
4142316Ity2b_mimmunity to S. typhimurium 2b (mouse)Not determined116718736579923086Mouse
27226783Tibl5_mtibia length 5, 5 week (mouse)1168300000102000000Mouse
1300651Pcyts3_mplasmacytoma susceptibility 3 (mouse)Not determined1170800372104800540Mouse
1301681Sle13_msystematic lupus erythematosus susceptibility 13 (mouse)Not determined1170800372104800540Mouse
1558812Rafar_mretinoic acid induced forelimb autopod reduction (mouse)Not determined1170800372104800540Mouse
4141339Nilac2_mnicotine induced locomotor activity 2 (mouse)Not determined1170800372104800540Mouse
1301404Sbmd4_mspinal bone mineral density 4 (mouse)Not determined1172128823106128908Mouse
1301078Alcp2_malcohol preference locus 2 (mouse)Not determined117231897084840636Mouse
1301310Tmevd5_mTheiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse)Not determined1172835299106835463Mouse
4142348Pstc2_mperiosteal circumference 2 (mouse)Not determined1172927789106927907Mouse
10043866Adip19_madiposity 19 (mouse)Not determined1172927789106927907Mouse
12903994Opfaq3_mopen field activity QTL 3 (mouse)117384671582178599Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:703391 UniSTS
NCBI Gene 62942 UniSTS
  68299 UniSTS
UniSTS 126534 UniSTS