D11Mit243 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D11Mit243

Symbol: D11Mit243
Also known as: MT3138; D11Mit243a; D11Mit243b; 
RGD ID: 4920048
Expected Size: 133 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381170,041,223 - 70,041,290UniSTSGRCm38
GRCm381170,041,158 - 70,041,290UniSTSGRCm38
MGSCv371169,854,660 - 69,854,792UniSTSGRCm37
MGSCv371169,854,725 - 69,854,792UniSTSGRCm37
Celera1177,589,626 - 77,589,758UniSTS
Celera1177,589,691 - 77,589,758UniSTS
Cytogenetic Map11B4UniSTS
cM Map1143.0UniSTS
cM Map11 UniSTS
Whitehead Genetic1137.2UniSTS
Whitehead_YAC11 UniSTS
Is Marker For: Genes:   Dlg4  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AAAGATTCACCAGGCACCC
Reverse Primer GTTCATACTTTGCTTGCAGATCC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
68631Dlg4discs large MAGUK scaffold protein 4117001720370045535Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
26884453Sklq16_mskull length QTL 16, 16 week (mouse)11330000072800000Mouse
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
1301788Lbw8_mlupus NZB x NZW 8 (mouse)Not determined113661246070618665Mouse
1301896Tria1_mT-cell receptor induced activation 1 (mouse)Not determined113672273870723028Mouse
4141853Skmw17_mskeletal muscle weight 17 (mouse)Not determined113719011571190238Mouse
10766457Nwa3_mNew Zealand White autoimmunity 3 (mouse)113812528972125383Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4141875Etax9_methanol induced ataxia 9 (mouse)Not determined5539415972319101Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
10053682Eae45_mexperimental allergic encephalomyelitis susceptibility 45 (mouse)Not determined115859972974863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse
1301987Pid3_mprior incubation determinant 3 (mouse)Not determined116179599488808902Mouse
1301319Dautb4_mdopamine uptake transporter binding 4 (mouse)Not determined116226517996265327Mouse
27226730Tibmd1_mtibia midshaft diameter 1, 5 week (mouse)1162700000109500000Mouse
1301999Lmr15_mleishmaniasis resistance 15 (mouse)Not determined116342858181939647Mouse
10044004Stzid3_mstreptozotocin induced diabetes susceptibility 3 (mouse)Not determined116342858194173092Mouse
11039501Ltpr6a_mLeishmania tropica response 6a (mouse)116493951098939647Mouse
11039502Ltpr6b_mLeishmania tropica response 6b (mouse)116493951098939647Mouse
11039515Ltpr6_mLeishmania tropica response 6 (mouse)116493951098939647Mouse
1301546Pcir2_mperiosteal circumference 2 (mouse)Not determined1166842594100842826Mouse
1357766Si5lq6_mserum IGFBP-5 level QTL 6 (mouse)Not determined1166842594100842826Mouse
4141012Femwf6_mfemur work to failure 6 (mouse)Not determined66842594100842826Mouse
1301833Tbbmd5_mtotal body bone mineral density 5 (mouse)Not determined1166842594100842826Mouse
1300784Prdt3_mprion disease incubation time 3 (mouse)Not determined1166842594100842826Mouse
1300628Lgth6_mbody length 6 (mouse)Not determined1166842594100842826Mouse
4142316Ity2b_mimmunity to S. typhimurium 2b (mouse)Not determined116718736579923086Mouse
27226783Tibl5_mtibia length 5, 5 week (mouse)1168300000102000000Mouse
36049778Ars6_mantibody response to SARS-CoV 6, day 15, IgM (mouse)116910000072600000Mouse
36049779Ars7_mantibody response to SARS-CoV 7, day 29, IgG1 (mouse)116910000072600000Mouse
36049784Ars8_mantibody response to SARS-CoV 8, day 29, IgG2a+IgG2c (mouse)116910000072600000Mouse
36049785Ars9_mantibody response to SARS-CoV 9, day 29, IgM (mouse)116910000072600000Mouse
36049786Ars10_mantibody response to SARS-CoV 10, 4 days post-rechallenge, IgG2a+IgG2c (mouse)116910000072600000Mouse
36049787Ars11_mantibody response to SARS-CoV 11, 4 days post-rechallenge, IgM (mouse)116910000072600000Mouse
36049788Ars1_mantibody response to SARS-CoV 1, day 7, IgG1 (mouse)116910000072600000Mouse
36049789Ars2_mantibody response to SARS-CoV 2, day 7, IgG2a+IgG2c (mouse)116910000072600000Mouse
36049790Ars3_mantibody response to SARS-CoV 3, day 7, IgG2b (mouse)116910000072600000Mouse
36049791Ars4_mantibody response to SARS-CoV 4, day 7, IgG3 (mouse)116910000072600000Mouse
36049792Ars5_mantibody response to SARS-CoV 5, day 7, IgM (mouse)116910000072600000Mouse
35673314Ari2_mantibody response to influenza 2, day 10, IgG3 (mouse)116910000072600000Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:700970 UniSTS
NCBI Gene 13385 UniSTS
UniSTS 126443 UniSTS