Crlf1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Crlf1

Symbol: Crlf1
Also known as: UniSTS:496824; 
RGD ID: 4912130
Expected Size: 0 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38870,498,806 - 70,499,152UniSTSGRCm38
MGSCv37873,022,705 - 73,023,051UniSTSGRCm37
Celera873,055,217 - 73,055,563UniSTS
Cytogenetic Map8C1UniSTS
cM Map8 UniSTS
Is Marker For: Genes:   Crlf1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGTCAGGAGACAATCTGGT
Reverse Primer ACGTGAGATCCTTCATGTTC
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3663327 UniSTS
NCBI Gene 12931 UniSTS
UniGene Mm.335584 UniSTS
UniSTS 496824 UniSTS