Ephb1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Ephb1

Symbol: Ephb1
Also known as:
RGD ID: 4911413
Expected Size: 528 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389101,922,503 - 101,923,030UniSTSGRCm38
MGSCv379101,824,833 - 101,825,360UniSTSGRCm37
Celera9101,458,703 - 101,459,231UniSTS
Cytogenetic Map9F1UniSTS
cM Map9 UniSTS
Is Marker For: Genes:   Ephb1  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATCCATCTCCCTTTGCTCATGACT
Reverse Primer ACCCAATTCAAACCACTCACCTGT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:3724289 UniSTS
  MGI:4411615 UniSTS
NCBI Gene 270190 UniSTS
UniGene Mm.22897 UniSTS
UniSTS 506883 UniSTS