Nfix Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Nfix

Symbol: Nfix
Also known as: UniSTS:474756; NoName; 
RGD ID: 4910130
Expected Size: 129 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38884,771,725 - 84,771,853UniSTSGRCm38
MGSCv37887,295,783 - 87,296,100UniSTSGRCm37
Celera889,071,567 - 89,071,696UniSTS
Cytogenetic Map8C1-C2UniSTS
cM Map838.6UniSTS
Is Marker For: Genes:   Nfix  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAGCCACATCACATTGGAG
Reverse Primer CTGAACAAATACCAGCAACTG
 

Region

Nucleotide Sequences
GenBank Nucleotide AC155163 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  AC161765 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
MGD MGI:4946194 UniSTS
NCBI Gene 18032 UniSTS
UniGene Mm.9394 UniSTS
UniSTS 532434 UniSTS