1810006K21Rik Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: 1810006K21Rik

Symbol: 1810006K21Rik
Also known as: UniSTS:474700; Tmem258; 
RGD ID: 4910032
Expected Size: 212 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm386101,146,245 - 101,146,456UniSTSGRCm38
GRCm381910,206,444 - 10,207,285UniSTSGRCm38
MGSCv376101,096,239 - 101,096,450UniSTSGRCm37
MGSCv371910,280,934 - 10,281,775UniSTSGRCm37
Celera6103,012,850 - 103,013,061UniSTS
Celera1910,902,362 - 10,903,203UniSTS
Cytogenetic Map19AUniSTS
cM Map19 UniSTS
cM Map196.54UniSTS
Is Marker For: Genes:   Tmem258   Gm19726  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CGTAGATGCCAACCCAGAGC
Reverse Primer GTACACCAGCCCAGTGAACC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
5140123Gm19726predicted gene, 197266101145340101146608Mouse
1623196Tmem258transmembrane protein 258191020420210207824Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse
1300704Cia3_mcollagen induced arthritis QTL 3 (mouse)Not determined696347325130347522Mouse
11040599Lmr4b_mleishmaniasis resistance 4b (mouse)696347325130347522Mouse
4141940W6q5_mweight 6 weeks QTL 5 (mouse)Not determined96655951146633626Mouse
4142416Egq11_mearly growth QTL 11 (mouse)Not determined96655951146633626Mouse
1357555Tesq2_mtestis weight QTL 2 (mouse)Not determined696655951146633626Mouse
10043923Bhr7_mbronchial hyperresponsiveness 7 (mouse)Not determined698242853132242977Mouse
1301518Bbaa5_mB.burgdorferi-associated arthritis 5 (mouse)Not determined698506837145935444Mouse
1301923Lith6_mlithogenic gene 6 (mouse)Not determined698717516132717715Mouse
1301915Chab3_mcholesterol absorption 3 (mouse)Not determined698931748132940036Mouse
1302131Bmd8_mbone mineral density 8 (mouse)Not determined699155128133155267Mouse
1300776Lfp3_mlong free running period 3 (mouse)Not determined19120278703Mouse
4142161Drinksac2_mdrink saccharin 2 (mouse)Not determined120645286Mouse
4142302Nstr1_mnerve sheath tumor resistance QTL 1 (mouse)Not determined19122321310Mouse
1301271Datd_mdopamine transporter density (mouse)Not determined19132362870Mouse
4142406Pbctlp1_mperipheral blood cytotoxic T lymphocyte percentage 1 (mouse)Not determined132897810Mouse
1300904Chab5_mcholesterol absorption 5 (mouse)Not determined19167640035676563Mouse
26884385Skwq14_mskull length QTL 14, 16 week (mouse)19320000035900000Mouse
1357819Tgct2_mtesticular germ cell tumor 2 (mouse)Not determined19327855120562299Mouse
1300923Bits4_mbitterness sensitivity 4 (mouse)Not determined19334585237345984Mouse
1301800Faq10_mfluctuating asymmetry QTL 10 (mouse)Not determined19334585237345984Mouse
1300591Pas3_mpulmonary adenoma susceptibility 3 (mouse)Not determined19334585237345984Mouse
1302126Skull26_mskull morphology 26 (mouse)Not determined19334585237345984Mouse
11039522Tbbr4_mTrypanosoma brucei brucei response 4 (mouse)19533596239336106Mouse
1301228Iba4_minduction of brown adipocytes 4 (mouse)Not determined19932831543328421Mouse
1302019Pgia23_mproteoglycan induced arthritis 23 (mouse)Not determined19981005343810202Mouse
38455997Cdtm2_mCD62L+ CD8 TM cells 2 (mouse)191000000020000000Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:3604540 UniSTS
NCBI Gene 100503493 UniSTS
  69038 UniSTS
UniSTS 474700 UniSTS