AU024588 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AU024588

Symbol: AU024588
Also known as: 364645; 
RGD ID: 4906205
Expected Size: 131 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381395,337,545 - 95,337,675UniSTSGRCm38
GRCm38690,518,347 - 90,518,477UniSTSGRCm38
MGSCv371396,107,500 - 96,107,630UniSTSGRCm37
MGSCv37690,468,341 - 90,468,471UniSTSGRCm37
Celera1398,958,906 - 98,959,036UniSTS
Cytogenetic Map13D1UniSTS
Whitehead/MRC_RH13831.49UniSTS
Is Marker For: Genes:   Zbed3  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AATGGTCAGATTGCCCTTTC
Reverse Primer TTCTGAAGCCCCTTCTTTTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1553288Zbed3zinc finger, BED type containing 3139532360595337842Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4142147Mvwf4_mmodifier of von Willebrand factor 4 (mouse)Not determined20293442112761890Mouse
10412235Scgq5_mspontaneous crescentic glomerulonephritis QTL 5 (mouse)Not determined133587692596102654Mouse
4142241Tailq3_mtail length QTL 3 (mouse)Not determined55572541112294569Mouse
4141992W6q16_mweight 6 weeks QTL 16 (mouse)Not determined55572541112294569Mouse
4142314Tailaq3_mtail length adjusted QTL 3 (mouse)Not determined55572541112294569Mouse
4140959W10q17_mweight 10 weeks QTL 17 (mouse)Not determined55572541112294569Mouse
10402414Sgp5_mserum gp70 production 5 (mouse)Not determined1356322643105285678Mouse
1357553Cia28_mcollagen induced arthritis 28 (mouse)Not determined135648143696102654Mouse
1300941Skl6_mskeletal size (tail length) 6 (mouse)Not determined136410270298102826Mouse
1301949Skull20_mskull morphology 20 (mouse)Not determined136410270298102826Mouse
1301445Listr2_mlisteriosis resistance 2 (mouse)Not determined1366596482100596627Mouse
1301593Heal8_mwound healing/regeneration 8 (mouse)Not determined1367905880101906000Mouse
14696726Kidrq3_mkidney weight, right QTL 3 (mouse)1368068947102068947Mouse
14747007Mancz11_mmandible centroid size 11 (mouse)1369963165103963165Mouse
4141266Mol3_mmodifier of LPS-response 3 (mouse)Not determined75984481112294569Mouse
1301610Dps1_mdelta power in slow-wave sleep 1 (mouse)Not determined137704774395594386Mouse
12880414V125Dq10_mvitamin D active form serum level QTL 10 (mouse)1377900000111900000Mouse
10045623Heal18_mwound healing regeneration 18 (mouse)Not determined1379102537113102654Mouse
1558741Ses10_msalmonella enteritidis susceptibility 10 (mouse)Not determined1382603460116603598Mouse
4142465Pbwg17_mpostnatal body weight growth 17 (mouse)Not determined1383739552117739748Mouse
14700691Cisaq1_mcoxsackieviral infection serum ALT QTL 1 (mouse)1386000000120000000Mouse
4140995Fbtq6_mfemoral bone trait QTL 6 (mouse)Not determined1386205109120205250Mouse
4141728Egaq4_mearly growth adjusted QTL 4 (mouse)Not determined87753866112294569Mouse
1300939Hrtfm6_mheart failure modifier 6 (mouse)Not determined1391247158120421639Mouse
1300876Tanidd2_mtally ho associated non-insulin dependednt diabetes mellitus 2 (mouse)Not determined1391828769120421639Mouse
1301142Heal2_mwound healing/regeneration 2 (mouse)Not determined1393738733120421639Mouse
4142338Skmw18_mskeletal muscle weight 18 (mouse)Not determined1394391865120421639Mouse
1558763Gct9_mgranulosa cell tumorigenesis 9 (mouse)Not determined1394900290120421639Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 72114 UniSTS
UniSTS 180580 UniSTS