AU017962 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AU017962

Symbol: AU017962
Also known as: 358020; 
RGD ID: 4905277
Expected Size: 105 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
Cytogenetic Map10D1UniSTS
Whitehead/MRC_RH101150.52UniSTS
Is Marker For: Genes:   AU017962   Gm6763   Gm8764   Gm4340   Gm20765   Gm21304   Gm21312   Gm21293  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCAACTTCACAAAAGCAAA
Reverse Primer TCTTTCTTTCTCCCCTTCTTTC
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 100043292 UniSTS
  100861880 UniSTS
  100861891 UniSTS
  100861901 UniSTS
  103341 UniSTS
  627488 UniSTS
  637578 UniSTS
  667692 UniSTS
UniGene Mm.339215 UniSTS
  Mm.441727 UniSTS
UniSTS 180114 UniSTS