AF045565 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AF045565

Symbol: AF045565
Also known as: ND; 
RGD ID: 4905056
Expected Size: 135 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm389122,930,847 - 122,930,980UniSTSGRCm38
GRCm38151,899,772 - 51,899,905UniSTSGRCm38
MGSCv37151,956,616 - 51,956,749UniSTSGRCm37
MGSCv379122,839,965 - 122,840,098UniSTSGRCm37
Celera9123,384,142 - 123,384,275UniSTS
Celera152,438,266 - 52,438,399UniSTS
Cytogenetic Map9F4UniSTS
Cytogenetic Map1C1.1UniSTS
cM Map972.0UniSTS
Whitehead/MRC_RH91220.95UniSTS
Is Marker For: Genes:   Myo1b   Zfp105  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGAGTACGATGCCCTGCTTT
Reverse Primer TGTGTGTTTACATTACCTTCCAGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
731319Myo1bmyosin IB15174975851916063Mouse
1320504Zfp105zinc finger protein 1059122923039122935260Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13824984Twq5_mtestis weight QTL 5 (mouse)13000000185000000Mouse
1301240Sluc15_msusceptibility to lung cancer 15 (mouse)Not determined11902627053026373Mouse
1301073Orch5_mautoimmune orchitis resistance 5 (mouse)Not determined11902627053026373Mouse
1301756Pgia1_mproteoglycan induced arthritis 1 (mouse)Not determined11902627053026373Mouse
12880407V125Dq2_mvitamin D active form serum level QTL 2 (mouse)11930000053300000Mouse
1357475w3q13_mweight 3 weeks QTL 13 (mouse)Not determined12307051073937756Mouse
4142433Hbnr1_mHeligmosomoides bakeri nematode resistance 1 (mouse)Not determined2551111058234112Mouse
11100001Col4a1m1_mcollagen, type IV, alpha 1 modifier 1 (mouse)12551111062907723Mouse
12880409V125Dq1_mvitamin D active form serum level QTL 1 (mouse)12600000060000000Mouse
1357822Lvrq3_mliver weight QTL 3 (mouse)Not determined13472105773937756Mouse
1357759W3q12_mweight 3 weeks QTL 12 (mouse)Not determined13472105773937756Mouse
1357651Lgq5_mlate growth QTL 5 (mouse)Not determined13472105773937756Mouse
1357506W10q6_mweight 10 weeks QTL 6 (mouse)Not determined13472105773937756Mouse
1357524W6q14_mweight 6 weeks QTL 14 (mouse)Not determined13472105773937756Mouse
1357824Estoq4_membryo survival total QTL 4 (mouse)Not determined13472105773937756Mouse
39128207Lwq16_mliver weight QTL 16 (mouse)13472105773937756Mouse
1357753Kidq2_mkidney weight QTL 2 (mouse)Not determined134721057150318120Mouse
1357488Splq3_mspleen weight QTL 3 (mouse)Not determined134721057150318120Mouse
1558860W10q7_mweight 10 weeks QTL 7 (mouse)Not determined134721057150318120Mouse
1301954Lrnx11_mlearning-contextual 11 (mouse)Not determined13909372774477206Mouse
1357721Sle17_msystematic lupus erythematosus susceptibility 17 (mouse)Not determined139093727126517573Mouse
12910780Pwgrq11_mpost-weaning growth rate QTL 11 (mouse)14082884867231097Mouse
12910786Pwgrq10_mpost-weaning growth rate QTL 10 (mouse)14082884867231097Mouse
12910788Pwgrq9_mpost-weaning growth rate QTL 9 (mouse)14082884867231097Mouse
1301166Thypr2_mthymocyte proliferative response 2 (mouse)Not determined14123396575234112Mouse
18182931Metl1_mmetabolite locus 1, pyridoxate (mouse)14123624075236240Mouse
4141032Wbcc1_mwhite blood cell count 1 (mouse)Not determined4222050876220508Mouse
1301714Vertcling_mvertical clinging (mouse)Not determined14289887276899008Mouse
12879917Shm3_msperm head morphology 3 (mouse)14414774462907723Mouse
10412179Habiir1_mhyperoxic acute lung injury imprinted region 1 (mouse)Not determined14537861351924960Mouse
1558855Eae30_mexperimental allergic encephalomyelitis susceptibility 30 (mouse)Not determined14537861372935898Mouse
1301722Cia9_mcollagen induced arthritis QTL 9 (mouse)Not determined145744740189571420Mouse
1301670Ssta1_msusceptibility to Salmonella typhimurium antigens 1 (mouse)Not determined14590759679907723Mouse
1301225Sle7_msystematic lupus erythematosus susceptibility 7 (mouse)Not determined14681553180815680Mouse
1301616Yaa2_mY-linked autoimmune acceleration 2 (mouse)Not determined14681553180815680Mouse
1558905Gct7_mgranulosa cell tumorigenesis 7 (mouse)Not determined14731073581310854Mouse
1558822Vas1_mautoimmune vasitis resistance 1 (mouse)Not determined14884984782850051Mouse
1301211Bbaa11_mB.burgdorferi-associated arthritis 11 (mouse)Not determined14884984782850051Mouse
1301430Cdcs2_mcytokine deficiency colitis susceptibility 2 (mouse)Not determined14885318682853326Mouse
10043965Obq24_mobesity QTL 24 (mouse)Not determined15085105784851057Mouse
4141305Tgq9_mtriglyceride QTL 9 (mouse)Not determined5138244685382446Mouse
10412242Alpq8_malcohol preference QTL 8 (mouse)Not determined989284925123284925Mouse
1301649Psl1_mpromotion susceptibility QTL 1 (mouse)Not determined989412277123412396Mouse
18182932Metl3_mmetabolite locus 3, N-acetylglutamate (mouse)989563342123563342Mouse
12910770Splic1_mspleen iron content 1 (mouse)991413879124595110Mouse
12910772Lvic6_mliver iron content 6 (mouse)991413879124595110Mouse
12910773Splic3_mspleen iron content 3 (mouse)991413879124595110Mouse
1558767Skmw11_mskeletal muscle weight 11 (mouse)Not determined991641084124595110Mouse
13463474Hbbcq5_mhemoglobin concentration QTL 5 (mouse)991641084124595110Mouse
13463475Hctq7_mhematocrit QTL 7 (mouse)991641084124595110Mouse
13463477Rbc9_mred blood cell count 9 (mouse)991641084124595110Mouse
13463478Mchq18_mmean corpuscular hemoglobin QTL 18 (mouse)991641084124595110Mouse
13463480Mchcq2_mmean corpuscular hemoglobin concentration QTL 2 (mouse)991641084124595110Mouse
12904937Edlmmq9_mextensor digitorum longus muscle mass QTL 9 (mouse)991683173124595110Mouse
12904947Tammq7_mtibialis anterior muscle mass QTL 7 (mouse)991683173124595110Mouse
12904961Gmmq7_mgastrocnemius muscle mass QTL 7 (mouse)991683173124595110Mouse
1302001Bdln5_mbody length 5 (mouse)Not determined993762590124595110Mouse
1301484Bwq6_mbody weight (mouse)Not determined993762590124595110Mouse
14746992Manh67_mmandible shape 67 (mouse)994036768124595110Mouse
11537364Cnes5_mC. neoformans susceptibility locus 5 (mouse)996917590124595110Mouse
1301297Lcho1_mliver cholesterol 1 (mouse)Not determined9101060861124595110Mouse
1357627Tgq2_mtriglyceride QTL 2 (mouse)Not determined9102000187124595110Mouse
1357648Obq18_mobesity QTL 18 (mouse)Not determined9102000187124595110Mouse
1301789Pbwg4_mpostnatal body weight growth 4 (mouse)Not determined9103289445124595110Mouse
10412290Pvacm1l_mplasma vascular cell adhesion molecule 1 levels (mouse)Not determined9103289445124595110Mouse
12879896Berr3_mberghei resistance locus 3 (mouse)9103289445124595110Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 17912 UniSTS
  22646 UniSTS
UniGene Mm.290595 UniSTS
UniSTS 180002 UniSTS