AV343731 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AV343731

Symbol: AV343731
Also known as: 845503; 
RGD ID: 4904645
Expected Size: 110 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm388104,550,170 - 104,550,279UniSTSGRCm38
MGSCv378107,074,070 - 107,074,179UniSTSGRCm37
Celera8108,782,561 - 108,782,670UniSTS
Cytogenetic Map8D1UniSTS
Whitehead/MRC_RH81230.54UniSTS
Is Marker For: Genes:   Car7  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTACAATAGCACCCAGACGC
Reverse Primer GCTGGGTAAGAACAAAGGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1315687Car7carbonic anhydrase 78104534694104550347Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
1558780Idd22_minsulin dependent diabetes susceptibility 22 (mouse)Not determined871102903105103009Mouse
4142023W3q5_mweight 3 weeks QTL 5 (mouse)Not determined71287817123895615Mouse
1357708Orq1_movulation rate QTL 1 (mouse)Not determined871287817123895615Mouse
1301872Cd4ts3_mCD4 T cell subset 3 (mouse)Not determined871396181105396393Mouse
1300920Pitm3_mprion incubation time 3 (mouse)Not determined873202495107202598Mouse
27095912Pglq14_mpelvic girdle length QTL 14, 16 week (mouse)873400000126100000Mouse
1558890Lith18_mlithogenic gene 18 (mouse)Not determined875675517109675623Mouse
1357470Obq16_mobesity QTL 16 (mouse)Not determined875685348109685497Mouse
1301808Nhdlq1_mnon-HDL QTL 1 (mouse)Not determined875685348109685497Mouse
1301874Hdlq16_mHDL QTL 16 (mouse)Not determined875685348109685497Mouse
10412234Nhdlq14_mnon-HDL QTL 14 (mouse)Not determined875685348109685497Mouse
1301099Cbm2_mcerebellum weight 2 (mouse)Not determined878518613112518703Mouse
1301581Char2_mP. chabaudi malaria resistance QTL 2 (mouse)Not determined879082178113082403Mouse
10755530Wbc2_mwhite blood cell count 2 (mouse)881092664115092664Mouse
10755519Wbc1_mwhite blood cell count 1 (mouse)881619151115619151Mouse
1301766Desp1_mdespair 1 (mouse)Not determined884759576118759741Mouse
1302049Heal1_mwound healing/regeneration 1 (mouse)Not determined885716921119717069Mouse
1301253Skmw2_mskeletal muscle weight 2 (mouse)Not determined885716921119717069Mouse
10045619Heal14_mwound healing/regeneration 14 (mouse)Not determined885716921119717069Mouse
27226796Scvln16_msacral vertebrae length 2, 16 week (mouse)889000000130800000Mouse
1357494Obsty2_mobesity 2 (mouse)Not determined895518613129018580Mouse
12880431Fgf23lq2_mFGF23 serum level QTL 2 (mouse)896900000129401213Mouse
11252141Fdr2_mfat response to dietary restriction 2 (mouse)897663894129401213Mouse
1301481Lith11_mlithogenic gene 11 (mouse)Not determined897836895129401213Mouse
1301080Sluc9_msusceptibility to lung cancer 9 (mouse)Not determined899101792129401213Mouse
1302105Im1_mImmunoregulatory 1 (mouse)Not determined899101792129401213Mouse
4141435Fbtq3_mfemoral bone trait QTL 3 (mouse)Not determined8100238570129401213Mouse
1300560Tgl1_mtriglyceride level 1 (mouse)Not determined8101759576110923404Mouse
1300681Pgia22_mproteoglycan induced arthritis 22 (mouse)Not determined8101759576115298718Mouse
1301316Dntcs1_mdental caries susceptibility 1 (mouse)Not determined8102716921127055036Mouse
11532691Sluc38_msusceptibility to lung cancer 38 (mouse)8104307238129401213Mouse
11532692Sluc38a_msusceptibility to lung cancer 38a (mouse)8104307238129401213Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 12354 UniSTS
UniGene Mm.129265 UniSTS
UniSTS 179797 UniSTS