AU040152 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: AU040152

Symbol: AU040152
Also known as: 402218; 
RGD ID: 4903897
Expected Size: 132 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381175,885,867 - 75,885,998UniSTSGRCm38
GRCm38695,129,466 - 95,129,597UniSTSGRCm38
MGSCv371175,699,369 - 75,699,500UniSTSGRCm37
MGSCv37695,079,460 - 95,079,591UniSTSGRCm37
Celera1183,395,210 - 83,395,341UniSTS
Celera697,015,596 - 97,015,727UniSTS
Cytogenetic Map11B4UniSTS
Cytogenetic Map6D2UniSTS
Whitehead/MRC_RH6979.38UniSTS
Is Marker For: Genes:   Kbtbd8   Rph3al  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTGTGCAATTACGGCAAAAT
Reverse Primer GTGAGGAACCAGAGTCCCAT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1551619Rph3alrabphilin 3A-like (without C2 domains)117583099275967614Mouse
1557457Kbtbd8kelch repeat and BTB (POZ) domain containing 869511788095129793Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse
1301987Pid3_mprior incubation determinant 3 (mouse)Not determined116179599488808902Mouse
1301319Dautb4_mdopamine uptake transporter binding 4 (mouse)Not determined116226517996265327Mouse
27226730Tibmd1_mtibia midshaft diameter 1, 5 week (mouse)1162700000109500000Mouse
1301999Lmr15_mleishmaniasis resistance 15 (mouse)Not determined116342858181939647Mouse
10044004Stzid3_mstreptozotocin induced diabetes susceptibility 3 (mouse)Not determined116342858194173092Mouse
11039501Ltpr6a_mLeishmania tropica response 6a (mouse)116493951098939647Mouse
11039502Ltpr6b_mLeishmania tropica response 6b (mouse)116493951098939647Mouse
11039515Ltpr6_mLeishmania tropica response 6 (mouse)116493951098939647Mouse
1301546Pcir2_mperiosteal circumference 2 (mouse)Not determined1166842594100842826Mouse
1357766Si5lq6_mserum IGFBP-5 level QTL 6 (mouse)Not determined1166842594100842826Mouse
4141012Femwf6_mfemur work to failure 6 (mouse)Not determined66842594100842826Mouse
1301833Tbbmd5_mtotal body bone mineral density 5 (mouse)Not determined1166842594100842826Mouse
1300784Prdt3_mprion disease incubation time 3 (mouse)Not determined1166842594100842826Mouse
1300628Lgth6_mbody length 6 (mouse)Not determined1166842594100842826Mouse
4142316Ity2b_mimmunity to S. typhimurium 2b (mouse)Not determined116718736579923086Mouse
27226783Tibl5_mtibia length 5, 5 week (mouse)1168300000102000000Mouse
1300651Pcyts3_mplasmacytoma susceptibility 3 (mouse)Not determined1170800372104800540Mouse
1301681Sle13_msystematic lupus erythematosus susceptibility 13 (mouse)Not determined1170800372104800540Mouse
1558812Rafar_mretinoic acid induced forelimb autopod reduction (mouse)Not determined1170800372104800540Mouse
4141339Nilac2_mnicotine induced locomotor activity 2 (mouse)Not determined1170800372104800540Mouse
1301404Sbmd4_mspinal bone mineral density 4 (mouse)Not determined1172128823106128908Mouse
1301078Alcp2_malcohol preference locus 2 (mouse)Not determined117231897084840636Mouse
1301310Tmevd5_mTheiler's murine encephalomyelitis virus induced demyelinating disease susceptibility 5 (mouse)Not determined1172835299106835463Mouse
4142348Pstc2_mperiosteal circumference 2 (mouse)Not determined1172927789106927907Mouse
10043866Adip19_madiposity 19 (mouse)Not determined1172927789106927907Mouse
12903994Opfaq3_mopen field activity QTL 3 (mouse)117384671582178599Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse
1357875Pfat2_mpredicted fat percentage 2 (mouse)Not determined676463949110464093Mouse
13824985Alh1_mamplitude of lateral head displacement 1 (mouse)67800000097000000Mouse
4141376Dbm1_mdiabetes modifier 1 (mouse)Not determined678629504121115387Mouse
14696731Pairq1_mP. aeruginosa infection resistance QTL 1 (mouse)681500000102200000Mouse
10043864T2dm4sa_mtype 2 diabetes mellitus 4 in SMXA RI mice (mouse)Not determined683713869147052561Mouse
11251720Ewc4_methanol withdrawal and consumption 4 (mouse)684122513118122513Mouse
1301687Mnic2_mmacronutrient intake (mouse)Not determined686806805113544602Mouse
1301744Hdlq11_mHDL QTL 11 (mouse)Not determined687503360121503555Mouse
1301262Gasa3_mgastritis type A susceptibility locus 3 (mouse)Not determined689005405123005603Mouse
1301244Ichs_mimmediate cutaneous hypersensitivity QTL (mouse)Not determined690795610124795846Mouse
11532719Sluc45_msusceptibility to lung cancer 45 (mouse)69260730698258933Mouse
4141578Obrq1_mobesity resistance QTL 1 (mouse)Not determined92607306112004738Mouse
11353842Bmiq4_mbody mass index QTL 4 (mouse)692607306146429238Mouse
1301292Cfbw2_mcystic fibrosis body weight 2 (mouse)Not determined695004651129004738Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 243574 UniSTS
  380714 UniSTS
UniSTS 179420 UniSTS