RH129024 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: RH129024

Symbol: RH129024
Also known as:
RGD ID: 4900485
Expected Size: 150 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm3811111,276,831 - 111,276,980UniSTSGRCm38
GRCm381575,895,504 - 75,895,793UniSTSGRCm38
MGSCv3711111,138,145 - 111,138,294UniSTSGRCm37
MGSCv371575,725,934 - 75,726,223UniSTSGRCm37
Celera11123,027,195 - 123,027,344UniSTS
Celera1577,396,484 - 77,396,773UniSTS
Cytogenetic Map15D3UniSTS
Cytogenetic Map11E2UniSTS
Cytogenetic Map15E1UniSTS
Is Marker For: Genes:   Eef1d   Naprt   Gm11675  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TTTAATCTCAGCAGTGCTCACACA
Reverse Primer TAGAGGATGACAAAGTGGGCA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2294031Gm11675predicted gene 1167511111276033111276994Mouse
1323466Eef1deukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)157589479675909784Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300957Pbd1_mpeak bone density 1 (mouse)Not determined11102453297112493297Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
10045616Heal25_mwound healing/regeneration 25 (mouse)Not determined1177546357111546496Mouse
14700694Ppiq13_mprepulse inhibition QTL 13 (mouse)11101613994114581537Mouse
1300962Cd8mts4_mCD8 memory T cell subset 4 (mouse)Not determined1196246848122082543Mouse
1300944Alcp20_malcohol preference locus 20 (mouse)Not determined1195513139122082543Mouse
11341721Rvfs2_mRift Valley fever susceptibility 2 (mouse)11100363360120996339Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
10413882Moe1_mmodifier of epilepsy 1 (mouse)1177880152111880273Mouse
27226731Tibmd4_mtibia midshaft diameter 4, 10 week (mouse)1194300000119000000Mouse
10044001Alcw8_malcohol withdrawal 8 (mouse)Not determined1199363361122082543Mouse
14700695Ppiq14_mprepulse inhibition QTL 14 (mouse)11101613994114581537Mouse
4141465Dbm2_mdiabetes modifier 2 (mouse)Not determined94546357118131898Mouse
1300649Crhq1_mcompensatory renal hypertrophy QTL 1 (mouse)Not determined1181683655115683810Mouse
10043976Obq33_mobesity QTL 33 (mouse)Not determined1198609643122082543Mouse
1301012Vispl_mvisual placing (mouse)Not determined11101131764122082543Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
14747003Mancz9_mmandible centroid size 9 (mouse)1185954085119954085Mouse
4141612Cia40_mcollagen induced arthritis 40 (mouse)Not determined11103383166115130618Mouse
1301095El6_mepilepsy 6 (mouse)Not determined1193338357122082543Mouse
1301072Eae22_mexperimental allergic encephalomyelitis 22 (mouse)Not determined1182486872116486994Mouse
1300766Skull16_mskull morphology 16 (mouse)Not determined1181683655115683810Mouse
14700693Ppiq12_mprepulse inhibition QTL 12 (mouse)11101613994114581537Mouse
10044007Hbnr14_mHeligmosomoides bakeri nematode resistance 14 (mouse)Not determined1187611774121611872Mouse
14700696Ppiq15_mprepulse inhibition QTL 15 (mouse)11101613994114581537Mouse
1301983Berr2_mberghei resistance locus 2 (mouse)Not determined1198461783122082543Mouse
10045617Heal26_mwound healing/regeneration 26 (mouse)Not determined1193048547112653728Mouse
1301057Nidd4_mnon-insulin-dependent diabetes mellitus 4 (mouse)Not determined1196919310122082543Mouse
1302034Pkccl_mprotein kinase C content in lungs (mouse)Not determined1191713782122082543Mouse
11553867Stmm5_mskin tumor modifier of MSM 5 (mouse)11100167277122082543Mouse
25394548Skmw74_mskeletal muscle weight 74, EDL (mouse)11111144720111811380Mouse
1301958Alcp18_malcohol preference locus 18 (mouse)Not determined1195513139122082543Mouse
15014785Mvlq1_mmacrovesicular liver lesion QTL 1 (mouse)1186717494120717494Mouse
10412288Carg4_mCandida albicans resistance gene 4 (mouse)Not determined1181919441115919441Mouse
1558753Ath19_matherosclerosis 19 (mouse)Not determined1191713782122082543Mouse
14746970Manh71_mmandible shape 71 (mouse)1179525431113525431Mouse
15039374Adip29_madiposity 29 (mouse)1186717494120717494Mouse
1301414Heal10_mwound healing/regeneration 10 (mouse)Not determined1177546357111546496Mouse
27226789Feml16_mfemur length 16, 10 week (mouse)1187600000126900000Mouse
15039376Bw42_mbody weight QTL 42 (mouse)1186717494120717494Mouse
4141939Pregq2_mpregnancy QTL 2 (mouse)Not determined1194172953118131898Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
11251723Ewc5_methanol withdrawal and consumption 5 (mouse)1189978425122082543Mouse
1357407Pfat4_mpredicted fat percentage 4 (mouse)8.6Body fat amountpredicted fat percentage155724515691245304Mouse
27226729Tibmd2_mtibia midshaft diameter 2, 5 week (mouse)153800000086800000Mouse
26884442Sklq6_mskull length QTL 6, 5 week (mouse)156100000100900000Mouse
4141921Pstc3_mperiosteal circumference 3 (mouse)Not determined1567386497101386646Mouse
15092079Igly6_mIgG glycosylation 6, GP6 (mouse)157422869182789955Mouse
4141135Cia35_mcollagen induced arthritis 35 (mouse)Not determined156492762598927745Mouse
1301860Gct3_mgranulosa cell tumorigenesis 3 (mouse)Not determined154753774781537842Mouse
1301568Tria2_mT-cell receptor induced activation 2 (mouse)Not determined154498729278987432Mouse
27095936Ulnl4_mulna length 4, 5 week (mouse)155690000087800000Mouse
1300800Ses3_msalmonella enteritidis susceptibility 3 (mouse)Not determined155724515691245304Mouse
27226773Tibl16_mtibia length 16, 10 week (mouse)15690000076000000Mouse
26884425Cvht2_mcranial vault height 2, 5 week (mouse)1528800000102100000Mouse
1301601Faq9_mfluctuating asymmetry QTL 9 (mouse)Not determined156327970297279794Mouse
1558786Msq1_mMAV-1 susceptibility QTL 1 (mouse)Not determined156351779781202235Mouse
1357526Hyplip2_mhyperlipidemia 2 (mouse)Not determined1512402117102988123Mouse
1300644Fob3_mF-line obesity QTL 3 (mouse)11.3Not determined154414443889377036Mouse
1301429Pcir3_mperiosteal circumference 3 (mouse)Not determined154859351382593647Mouse
13442492Mecth2_mmechanosensation threshold 2 (mouse)157479100079503000Mouse
1357756Alaa4_malopecia areata 4 (mouse)Not determined154651779780517996Mouse
1302002Cocia2_mcocaine induced activation 2 (mouse)Not determined157250061080014977Mouse
1300844Emo2_memotionality 2 (mouse)Not determined157250061076910293Mouse
12791003Aath8_maortic arch atherosclerosis 8 (mouse)1573545941104043685Mouse
26884399Humsd1_mhumerus midshaft diameter 1, 5 week (mouse)1548500000101800000Mouse
1301171Brm2_mbrachyury modifier 2 (mouse)Not determined156564117599641298Mouse
1357559Scfq2_msubcutaneous fat pad weight QTL 2 (mouse)Not determined15346021278717086Mouse
1357703Vtbt17_mvertebral trabecular bone trait 17 (mouse)Not determined154468146478681588Mouse
4141952W3q7_mweight 3 weeks QTL 7 (mouse)Not determined346021278717086Mouse
1301472Pain1_mpain 1 (mouse)Not determined157544899790928982Mouse
27226777Tibl8_mtibia length 8, 5 week (mouse)15690000084700000Mouse
25671381Hrsq3_mhost response to SARS QTL 3, eosinophilia (mouse)157227269075972984Mouse
13504731Cath5_mcarotid atherosclerosis 5 (mouse)155491728088917280Mouse
1558985Eae32_mexperimental allergic encephalomyelitis susceptibility 32 (mouse)Not determined1532578270103517472Mouse
26884397Humsd5_mhumerus midshaft diameter 5, 10 week (mouse)154850000098500000Mouse
1302197Bhr2_mbronchial hyperresponsiveness 2 (mouse)Not determined1564434485103517472Mouse
1357659Epfpq4_mepididymal fat percentage QTL 4 (mouse)Not determined15346021278717086Mouse
27226717Tibw4_mtibia width 4, proximal, 10 week (mouse)15610000078800000Mouse
27095932Ulnl11_mulna length 11, 16 week (mouse)15610000076500000Mouse
1300726Pitm4_mprion incubation time 4 (mouse)Not determined1570465070104043685Mouse
10045637Heal27_mwound healing/regeneration 29 (mouse)Not determined155154651285546662Mouse
27226734Tibmd5_mtibia midshaft diameter 5, 10 week (mouse)15610000086800000Mouse
1301006Hfib1_mhepatic fibrogenesis 1 (mouse)Not determined154743448581434630Mouse
26884392Humsd8_mhumerus midshaft diameter 8, 16 week (mouse)152930000076200000Mouse
38501067Tip3_mtuberculosis immunophenotype 3, IFN-g level (mouse)155370000089700000Mouse
27226786Feml11_mfemur length 11, 5 week (mouse)15610000076000000Mouse
1301708Cocrb14_mcocaine related behavior 14 (mouse)Not determined155193466685934802Mouse
1300627Sluc26_msusceptibility to lung cancer 26 (mouse)Not determined1570461452104043685Mouse
4142198Hbtq_mhabituation QTL (mouse)Not determined155128885985288984Mouse
1301119Drb7_mdopamine receptor binding 7 (mouse)Not determined156545237799456827Mouse
10755515Amzn3_manatomical modifier of Zfp423 3 (mouse)154651779780517996Mouse
4142448Tailq6_mtail length QTL 6 (mouse)Not determined346021278717086Mouse
26884402Cvht9_mcranial vault height 9, 16 week (mouse)154230000095600000Mouse
4142252Tailaq4_mtail length adjusted QTL 4 (mouse)Not determined346021278717086Mouse
1302074Bmd4_mbone mineral density 4 (mouse)Not determined1556323312103517472Mouse
10412067Pain2_mpain 2 (mouse)Not determined155177349085773777Mouse
1302080Szs13_mseizure susceptibility 13 (mouse)Not determined155181398385822600Mouse
1300648Dbsty4_mdiabesity 4 (mouse)Not determined1570465070104043685Mouse
14747011Mancz13_mmandible centroid size 13 (mouse)1572498466104043685Mouse
1301433Rapop5_mradiation-induced apoptosis 5 (mouse)Not determined15927293679590561Mouse
1301779Dpml_mdopamine loss (mouse)Not determined155114129876910293Mouse
12880420V25Dq8_mvitamin D inactive form serum level QTL 8 (mouse)156170000095700000Mouse
27226721Tibw8_mtibia width 8, proximal, 16 week (mouse)15690000076000000Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 223646 UniSTS
  66656 UniSTS
  667003 UniSTS
UniSTS 212332 UniSTS