RH128354 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH128354

Symbol: RH128354
Also known as:
RGD ID: 4900375
Expected Size: 180 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38870,535,085 - 70,535,264UniSTSGRCm38
MGSCv37873,058,984 - 73,059,163UniSTSGRCm37
Celera873,091,510 - 73,091,689UniSTS
Cytogenetic Map8C1UniSTS
Is Marker For: Genes:   Fkbp8  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCAGGAAGGAATGGTAGTGCTG
Reverse Primer AGCAGGAAAGACTGAGACCCTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1318579Fkbp8FK506 binding protein 887052772170535328Mouse
15023081Gm51534predicted gene, 5153487053180670539529Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
10766466Char12_mP. chabaudi malaria resistance QTL 12 (mouse)86826982782600347Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
4142283Imraq2_mimmune response to AAV2 QTL 2 (mouse)Not determined870305375104305495Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
4140966Egq12_mearly growth QTL 12 (mouse)Not determined3201654471287993Mouse
1301767Fcsa2_mfemoral cross-sectional area 2 (mouse)Not determined870305375104305495Mouse
1558870Eae36_mexperimental allergic encephalomyelitis susceptibility 36 (mouse)Not determined81472316071045600Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
4141437W10q14_mweight 10 weeks QTL 14 (mouse)Not determined3201654471287993Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141172W6q9_mweight 6 weeks QTL 9 (mouse)Not determined3201654471287993Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
1357811Orq3_movulation rate QTL 3 (mouse)Not determined83201654471287993Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 14232 UniSTS
UniGene Mm.141864 UniSTS
UniSTS 211662 UniSTS