RH136129 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH136129

Symbol: RH136129
Also known as:
RGD ID: 4899173
Expected Size: 184 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38675,982,172 - 75,982,358UniSTSGRCm38
GRCm381127,954,333 - 127,954,516UniSTSGRCm38
MGSCv37675,932,166 - 75,932,352UniSTSGRCm37
MGSCv371129,850,910 - 129,851,093UniSTSGRCm37
Celera677,995,091 - 77,995,277UniSTS
Celera1130,583,070 - 130,583,253UniSTS
Cytogenetic Map1E4UniSTS
Is Marker For: Genes:   Zranb3  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCTCCTTGCTTGATTTCTG
Reverse Primer AGGAAACAAGGGAGCAAACA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1557935Zranb3zinc finger, RAN-binding domain containing 31127954179128103053Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
13824984Twq5_mtestis weight QTL 5 (mouse)13000000185000000Mouse
1357753Kidq2_mkidney weight QTL 2 (mouse)Not determined134721057150318120Mouse
1357488Splq3_mspleen weight QTL 3 (mouse)Not determined134721057150318120Mouse
1558860W10q7_mweight 10 weeks QTL 7 (mouse)Not determined134721057150318120Mouse
1301722Cia9_mcollagen induced arthritis QTL 9 (mouse)Not determined145744740189571420Mouse
4142291Aec2_mautoimmune exocrinopathy 2 (mouse)Not determined52418578182423027Mouse
10412185Hcs9_mhepatocarcinogenesis susceptibility 9 (mouse)Not determined163815531189571420Mouse
1300841Ssial1_msusceptibility to sialadenitis 1 (mouse)Not determined163880843153681816Mouse
27095918Ulnl1_mulna length 1, 5 week (mouse)167300000129800000Mouse
1300989Lrdg1_mlight induced retinal degeneration 1 (mouse)Not determined173716016147249632Mouse
4141914Gcsfis_mG-CSF induced splenomegaly (mouse)Not determined74477076148839837Mouse
1357847Jckm2_mjuvenile cystic kidney modifier 2 (mouse)Not determined174952818133363199Mouse
27095931Pglq1_mpelvic girdle length QTL 1, 5 week (mouse)176000000128600000Mouse
27095928Pglq6_mpelvic girdle length QTL 6, 10 week (mouse)176000000148900000Mouse
26884448Sklq1_mskull length QTL 1, 5 week (mouse)176000000181500000Mouse
1301350Nidd4k_mNidd4 on KK-A (mouse)Not determined782314261147249632Mouse
1357439Popoa_mpremature ovulation and primary oocyte arrest (mouse)Not determined182665468135687641Mouse
27095913Scvln2_msacral vertebrae length 2, 5 week (mouse)194200000148900000Mouse
27095901Scvln8_msacral vertebrae length 2, 10 week (mouse)194200000172200000Mouse
27226779Tibl1_mtibia length 1, 5 week (mouse)195600000162200000Mouse
1301123Cd8mts2_mCD8 memory T cell subset 2 (mouse)Not determined196690656130690827Mouse
1301753Tir3a_mtrypansomiasis infection response 3a (mouse)Not determined197126256131126460Mouse
1301536Pbbcp1_mperipheral blood B cell percentage 1 (mouse)Not determined199579930133580115Mouse
1301193Lxw3_mlupus BXSB x NZW 3 (mouse)Not determined1103040804137040937Mouse
10412162Nobq3_mNew Zealand obese QTL 3 (mouse)Not determined1104005680191493284Mouse
12790994Aaaq1_maortic arch angle QTL 1 (mouse)1109568206143568206Mouse
1301979Melm1_mmelanoma modifier 1 (mouse)Not determined1109710525143710742Mouse
1357600Obq17_mobesity QTL 17 (mouse)Not determined1110625442144625561Mouse
10401248Bglu12_mblood glucose level 12 (mouse)Not determined1110625442144625561Mouse
1301149Lrnx12_mlearning-contextual 12 (mouse)Not determined1112081092168358833Mouse
1302098Eila1_methanol induced locomotor activity 1 (mouse)Not determined1112081092175641372Mouse
1301249Sbw1_msplenomegaly-NZB x NZW 1 (mouse)Not determined1112203268146203348Mouse
10045640Jckm4_mjuvenile cystic kidney modifier 4 (mouse)Not determined1116363098150363199Mouse
27095915Scvln13_msacral vertebrae length 2, 16 week (mouse)1117600000180000000Mouse
1302161Exq2_mexploratory and excitability QTL 2 (mouse)Not determined1118171982152172078Mouse
27226714Metcl1_mmetatarsal-calcaneal length 1, 5 week (mouse)1121800000139800000Mouse
27226740Metcl13_mmetatarsal-calcaneal length 13, 16 week (mouse)1121800000153900000Mouse
27226743Metcl7_mmetatarsal-calcaneal length 7, 10 week (mouse)1121800000154000000Mouse
27226767Tibl10_mtibia length 10, 10 week (mouse)1121800000165000000Mouse
27226799Feml5_mfemur length 5, 5 week (mouse)1122100000165000000Mouse
12880408V125Dq3_mvitamin D active form serum level QTL 3 (mouse)1123000000157000000Mouse
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
26884441Sklq3_mskull length QTL 3, 5 week (mouse)6760000080600000Mouse
13208564Bmiq7_mbody mass index QTL 7 (mouse)62500000080000000Mouse
4141782Mrdq5_mmodifier of retinal degeneration QTL 5 (mouse)Not determined3285065078238974Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
1301266Lmr4_mleishmaniasis resistance 4 (mouse)Not determined64211637376116515Mouse
11040600Lmr4c_mleishmaniasis resistance 4c (mouse)64211637376116515Mouse
11040601Lmr4a_mleishmaniasis resistance 4a (mouse)64211637376116515Mouse
11533915Mts4_mmammary tumor susceptibility 4 (mouse)64211637376116515Mouse
12910785Pwgrq16_mpost-weaning growth rate QTL 16 (mouse)64382681377811523Mouse
12910798Pwgrq5_mpre-weaning growth rate QTL 5 (mouse)64382681377811523Mouse
12910802Pwbwq12_mpost-weaning body weight QTL 12 (mouse)64382681377811523Mouse
12910807Pwbwq11_mpost-weaning body weight QTL 11 (mouse)64382681377811523Mouse
12910809Pwbwq10_mpost-weaning body weight QTL 10 (mouse)64382681377811523Mouse
12910820Ogrq3_moverall growth rate QTL 3 (mouse)64382681377811523Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
4141990Etax6_methanol induced ataxia 6 (mouse)Not determined7132262186275719Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
1300869Stheal5_msoft tissue heal 5 (mouse)Not determined671575060105575178Mouse
1300954Fcsa1_mfemoral cross-sectional area 1 (mouse)Not determined671981024105981170Mouse
1301521Pas1c_mpulmonary adenoma susceptibility 1c (mouse)Not determined671981024105981170Mouse
13506930Recrq9_mrecombination rate in male meiosis QTL 9 (mouse)673500000134700000Mouse
1301320Ots1_movarian teratoma susceptibility 1 (mouse)Not determined675447583104503555Mouse
1301571Arrd1_mage-related retinal degeneration 1 (mouse)Not determined67554435692607450Mouse
1300674Nidd3n_mnon-insulin-dependent diabetes mellitus 3 in NSY (mouse)Not determined67554435694225955Mouse
10412195Efw_mepididymal fat weight (mouse)Not determined67554435694225955Mouse
10043901Pfat5_mpredicted fat percentage 5 (mouse)Not determined675607306109607450Mouse
10412208Cypr4_mcytokine production 4 (mouse)Not determined675716503109716697Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 226409 UniSTS
UniSTS 210124 UniSTS