RH135924 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH135924

Symbol: RH135924
Also known as:
RGD ID: 4898771
Expected Size: 190 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38948,488,756 - 48,488,945UniSTSGRCm38
GRCm38866,847,261 - 66,847,452UniSTSGRCm38
MGSCv37948,296,861 - 48,297,050UniSTSGRCm37
MGSCv37869,371,160 - 69,371,351UniSTSGRCm37
Celera945,785,754 - 45,785,943UniSTS
Celera869,407,039 - 69,407,230UniSTS
Cytogenetic Map8B3.3UniSTS
Cytogenetic Map9A5.3UniSTS
Is Marker For: Genes:   Rbm7   LOC665443  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAGGATCCACATTTTTCATGG
Reverse Primer CACAAAATGACAGTGTTGGTGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1614577LOC665443RNA binding motif protein 7 pseudogene86684582866847510Mouse
1317543Rbm7RNA binding motif protein 794848869748495330Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1558870Eae36_mexperimental allergic encephalomyelitis susceptibility 36 (mouse)Not determined81472316071045600Mouse
1357811Orq3_movulation rate QTL 3 (mouse)Not determined83201654471287993Mouse
4141437W10q14_mweight 10 weeks QTL 14 (mouse)Not determined3201654471287993Mouse
4141172W6q9_mweight 6 weeks QTL 9 (mouse)Not determined3201654471287993Mouse
4140966Egq12_mearly growth QTL 12 (mouse)Not determined3201654471287993Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1301936Trigq2_mtriglyceride QTL 2 (mouse)Not determined83383736267837502Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
1357637Si5lq2_mserum IGFBP-5 level QTL 2 (mouse)Not determined91550045549500594Mouse
4141447Cfmq2_mcystic fibrosis modifier QTL 2 (mouse)Not determined91550045549500594Mouse
4141591Cq4_mcholesterol QTL 4 (mouse)Not determined91550045549500594Mouse
1301421Lgth4_mbody length 4 (mouse)Not determined91550045549500594Mouse
11354951Pdcc3_mplasmacytoid dentritic cell compartment 3 (mouse)91583833149838331Mouse
12790993Adq1_maortic diameter QTL 1 (mouse)91583833149838331Mouse
12790997Adq2_maortic diameter QTL 2 (mouse)91583833149838331Mouse
12880415V125Dq7_mvitamin D active form serum level QTL 7 (mouse)91610000050100000Mouse
12880416V125Dq8_mvitamin D active form serum level QTL 8 (mouse)91610000050100000Mouse
13504834Hdlq109_mHDL QTL 109 (mouse)91679834550798345Mouse
1357465Vtbt6_mvertebral trabecular bone trait 6 (mouse)Not determined91706754451067647Mouse
1300643Pvcan2_mprotection against vaginal candidiasis 2 (mouse)Not determined92003211054032229Mouse
1301439Morph2_mmorphine antinociception 2 (mouse)Not determined92024206654242196Mouse
1301045Sluc10_msusceptibility to lung cancer 10 (mouse)Not determined92039490154395074Mouse
1301883Skull12_mskull morphology 12 (mouse)Not determined92039490154395074Mouse
4142352Lmr17_mleishmaniasis resistance 17 (mouse)Not determined92039490154395074Mouse
10043950Pbft5_mpercent body fat 5 (mouse)Not determined92039490154395074Mouse
12904939Edlmmq8_mextensor digitorum longus muscle mass QTL 8 (mouse)92094144454941444Mouse
13208563Bmiq8_mbody mass index QTL 8 (mouse)92500000069000000Mouse
11532694Sluc39a_msusceptibility to lung cancer 39a (mouse)92567618959676285Mouse
11532695Sluc39b_msusceptibility to lung cancer 39b (mouse)92567618959676285Mouse
11532696Sluc39c_msusceptibility to lung cancer 39c (mouse)92567618959676285Mouse
11532712Sluc39d_msusceptibility to lung cancer 39d (mouse)92567618959676285Mouse
1300932Hdlq17_mHDL QTL 17 (mouse)Not determined92688512460885255Mouse
10043867Mtbcq9_mmultiple trait body composition QTL 9 (mouse)Not determined92688512460885255Mouse
10043987Stheal13_msoft tissue heal 13 (mouse)Not determined92688512460885255Mouse
10043878Adip20_madiposity 20 (mouse)Not determined92733989761340026Mouse
10043847Hdlq89_mHDL QTL 89 (mouse)Not determined92938163163381774Mouse
1301782Chol11_mcholesterol 11 (mouse)Not determined92938163163381774Mouse
1301365Ap5q_malcohol preference 5 QTL (mouse)Not determined93014186664141979Mouse
1357746Vtbt7_mvertebral trabecular bone trait 7 (mouse)Not determined93082861764828723Mouse
1302180Actd4_mactivity-distance traveled 4 (mouse)Not determined93252326366523557Mouse
4141148Cq5_mcholesterol QTL 5 (mouse)Not determined93254112166541246Mouse
1301692Hts_mhypothermia sensitivity (mouse)Not determined93259987266600121Mouse
4141323Ptnu3_mproteinuria 3 (mouse)Not determined93297840266978536Mouse
1357709Si5lq3_mserum IGFBP-5 level QTL 3 (mouse)Not determined93319972567199840Mouse
1558872Ibdq1_minflammatory bowel disease QTL 1 (mouse)Not determined93406754473531973Mouse
1301252Etohc3_methanol consumption 3 (mouse)Not determined93512317869123299Mouse
1301972Cocrb8_mcocaine related behavior 8 (mouse)Not determined93512317869123299Mouse
1558968Tbdr1_mbody temperature response to dietary restriction, QTL 1 (mouse)Not determined93512317869123299Mouse
10045613Rapop7_mradiation-induced apoptosis 6 (mouse)Not determined93682494749509211Mouse
1301501Lmr2_mleishmaniasis resistance 2 (mouse)Not determined93703211050199840Mouse
4142042Alpq3_malcohol preference QTL 3 (mouse)Not determined93739490198819654Mouse
10043971Obq32_mobesity QTL 32 (mouse)Not determined93791224471912244Mouse
12791002Arlsq2_maortic root lesion size QTL 2 (mouse)93819229172192291Mouse
12790986Pcho9_mplasma cholesterol 9 (mouse)93819229172192291Mouse
12790992Arlsq1_maortic root lesion size QTL 1 (mouse)93819229172192291Mouse
12738449Spcq2_msperm count QTL 2 (mouse)93949260173492601Mouse
1558993Tdmq1_mtype 2 diabetes modifying QTL 1 (mouse)Not determined94050829851897370Mouse
4141071Ath29_matherosclerosis 29 (mouse)Not determined94050829874700643Mouse
1301702Brm1_mbrachyury modifier 1 (mouse)Not determined94089776474897921Mouse
1301558Stheal8_msoft tissue heal 8 (mouse)Not determined94357343177573577Mouse
10045639Heal28_mwound healing/regeneration 28 (mouse)Not determined94357343177573577Mouse
1301435Trigq1_mtriglyceride QTL 1 (mouse)Not determined94452089278520980Mouse
4141572Ntta3_mneurotensin transcript abundance 3 (mouse)Not determined4668637365923895Mouse
4141754Fecq4_mfecundity QTL 4 (mouse)Not determined94763172657897921Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 665443 UniSTS
  67010 UniSTS
UniGene Mm.471024 UniSTS
  Mm.76911 UniSTS
UniSTS 209921 UniSTS