RH126559 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH126559

Symbol: RH126559
Also known as:
RGD ID: 4898303
Expected Size: 234 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38867,514,060 - 67,514,292UniSTSGRCm38
GRCm387126,490,434 - 126,490,667UniSTSGRCm38
MGSCv377133,633,948 - 133,634,181UniSTSGRCm37
MGSCv37870,037,959 - 70,038,191UniSTSGRCm37
Celera870,067,517 - 70,067,749UniSTS
Celera7126,343,010 - 126,343,243UniSTS
Cytogenetic Map7F3UniSTS
Cytogenetic Map8B3.3UniSTS
Is Marker For: Genes:   Tufm   Gm9755  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer AGAAATGTCCAGAGGTGTACT
Reverse Primer TGGCCTTGTTACTGATGTA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2294158Gm9755predicted pseudogene 975586751400067515658Mouse
1552222TufmTu translation elongation factor, mitochondrial7126487271126490731Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1558870Eae36_mexperimental allergic encephalomyelitis susceptibility 36 (mouse)Not determined81472316071045600Mouse
1357811Orq3_movulation rate QTL 3 (mouse)Not determined83201654471287993Mouse
4141437W10q14_mweight 10 weeks QTL 14 (mouse)Not determined3201654471287993Mouse
4141172W6q9_mweight 6 weeks QTL 9 (mouse)Not determined3201654471287993Mouse
4140966Egq12_mearly growth QTL 12 (mouse)Not determined3201654471287993Mouse
4140967Bmd39_mbone mineral density 39 (mouse)Not determined832016544117238700Mouse
1301936Trigq2_mtriglyceride QTL 2 (mouse)Not determined83383736267837502Mouse
1558875Eae31_mexperimental allergic encephalomyelitis susceptibility 31 (mouse)Not determined834642776114837007Mouse
1301013Capsq4_mcapsaicin sensitivity related QTL 4 (mouse)Not determined83616300092728652Mouse
27226754Femd6_mfemur midshaft diameter 6, 10 week (mouse)837400000109600000Mouse
12904744Carcdq1_mcardiac collagen deposition QTL 1 (mouse)83970925694689598Mouse
1301544Iba3_minduction of brown adipocytes 3 (mouse)Not determined84429488078295025Mouse
1301717Adip4_madiposity 4 (mouse)Not determined84763703081637146Mouse
10766453Char11_mP. chabaudi malaria resistance QTL 11 (mouse)84763703081637146Mouse
1301441Skull11_mskull morphology 11 (mouse)Not determined84773713481737254Mouse
1357715Alaa3_malopecia areata 3 (mouse)Not determined84879293982793021Mouse
14746987Manh64_mmandible shape 64 (mouse)85005330684053306Mouse
14747005Mancz7_mmandible centroid size 7 (mouse)85005330684053306Mouse
14700686Civq3_mcerebral infarct volume QTL 3 (mouse)85188219185882191Mouse
1301506Aevm1_mautoimmune extremity vasculitis in MRL mice 1 (mouse)Not determined85428781788287993Mouse
1301952Im3_mimmunoregulatory 3 (mouse)Not determined85470661488706763Mouse
10412287Carg3_mCandida albicans resistance gene 3 (mouse)Not determined85554502889545028Mouse
11353828Gf7_mgonadal fat pad weight 7 (mouse)85820147992201479Mouse
10043975Obq31_mobesity QTL 31 (mouse)Not determined85840977692409776Mouse
1301688Orch6_mautoimmune orchitis resistance 6 (mouse)Not determined86078685094786976Mouse
4141285Tgq18_mtriglyceride QTL 18 (mouse)Not determined6346010797460107Mouse
4141797Skmw16_mskeletal muscle weight 16 (mouse)Not determined86393954797939696Mouse
1357787Vtbt5_mvertebral trabecular bone trait 5 (mouse)Not determined86535776899357920Mouse
10043992Hbnr11_mHeligmosomoides bakeri nematode resistance 11 (mouse)Not determined86560020799600347Mouse
25314307Mlh1fc2_mMLH1 foci count 2 (mouse)76500000133900000Mouse
1301158Eae4_msusceptibility to experimental allergic encephalomyelitis 4 (mouse)Not determined719413473142366067Mouse
27226751Femd5_mfemur midshaft diameter 5, 10 week (mouse)753600000143600000Mouse
27226778Femd11_mfemur midshaft diameter 11, 16 week (mouse)757300000134400000Mouse
26884440Sklq4_mskull length QTL 4, 5 week (mouse)765600000126900000Mouse
27095933Ulnl3_mulna length 3, 5 week (mouse)773500000143600000Mouse
26884398Humsd6_mhumerus midshaft diameter 6, 16 week (mouse)779000000137300000Mouse
27095930Ulnl10_mulna length 10, 16 week (mouse)781200000127100000Mouse
27095903Scvln10_msacral vertebrae length 2, 10 week (mouse)781800000126900000Mouse
27226765Tibl18_mtibia length 18, 16 week (mouse)782200000126900000Mouse
27226769Tibl12_mtibia length 12, 10 week (mouse)787600000126900000Mouse
27226790Feml15_mfemur length 15, 10 week (mouse)787600000126900000Mouse
1300528Ssial3_msusceptibility to sialadenitis 3 (mouse)Not determined793792641127792834Mouse
1301478Eae26_msusceptibility to experimental allergic encephalomyelitis 26 (mouse)Not determined798565687132565775Mouse
13524850Asrq7_macoustic startle response 7 (mouse)798795739132795739Mouse
10412104Tons2_mtongue size 2 (mouse)Not determined7100238481134238481Mouse
11039524Tbbr3_mTrypanosoma brucei brucei response 3 (mouse)7101151499135151620Mouse
1301447Fembm3_mfemoral bone morphometry 3 (mouse)Not determined7101394038135394119Mouse
1357460Vtbt4_mvertebral trabecular bone trait 4 (mouse)Not determined7102094158136094307Mouse
1301105Cfld4_mcystic fibrosis lung disease 4 (mouse)Not determined7102094158136094307Mouse
1300721Cfbw3_mcystic fibrosis body weight 3 (mouse)Not determined7102094158136094307Mouse
4142312Nilac4_mnicotine induced locomotor activity 4 (mouse)Not determined7102885996136886157Mouse
5491192Mobq1_mmultigenic obesity QTL 1 (mouse)Not determined7105651440139651588Mouse
13524852Asrq7a_macoustic startle response 7a (mouse)7105750785139750785Mouse
14700684Civq1_mcerebral infarct volume QTL 1 (mouse)7110108163144108163Mouse
14700687Civq5_mcerebral infarct volume QTL 5 (mouse)7110108163144108163Mouse
14700688Civq6_mcerebral infarct volume QTL 6 (mouse)7110108163144108163Mouse
10402499Lmr21_mleishmaniasis resistance 21 (mouse)Not determined7111365511145365612Mouse
11059562Lmr21b_mleishmaniasis resistance 21b (mouse)7111365511145365612Mouse
1301898Alcp14_malcohol preference locus 14 (mouse)Not determined7111564398145441459Mouse
1302032Alcp12_malcohol preference locus 12 (mouse)Not determined7111564398145441459Mouse
1300670Sluc19_msusceptibility to lung cancer 19 (mouse)Not determined7111564398145441459Mouse
4142444Femwf5_mfemur work to failure 5 (mouse)Not determined112950524145441459Mouse
1300747Skts2_mskin tumor susceptibility 2 (mouse)Not determined7113321003145441459Mouse
38501072Stsl7_mSalmonella typhimurium susceptibility locus 7 (mouse)7116100000128900000Mouse
1300677Bmd9_mbone mineral density 9 (mouse)Not determined7117032360145441459Mouse
15092059Wogrme1_mweek one growth rate, maternal effect 1 (mouse)7117600000134500000Mouse
11059561Lmr21a_mleishmaniasis resistance 21a (mouse)7118151499128365612Mouse
1357711Adbg1_madult body growth 1 (mouse)Not determined7119094158144844577Mouse
1301773Stheal7_msoft tissue heal 7 (mouse)Not determined7119530844145441459Mouse
38501070Tip5_mtuberculosis immunophenotype 5, IFN-g level (mouse)7121000000130700000Mouse
1357613Bsbob2_mBSB obesity 2 (mouse)Not determined7122651440129217600Mouse
1301903Tlsm1_mthymic lymphoma susceptible 1 (mouse)Not determined7122651440135569172Mouse
38501066Tip2_mtuberculosis immunophenotype 2, spleen CFU (mouse)7124700000127300000Mouse
4141945Il4ppq_mIL-4 producing potential QTL (mouse)Not determined7124914439129217600Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 100041265 UniSTS
  233870 UniSTS
UniSTS 209686 UniSTS