Siat9 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Siat9

Symbol: Siat9
Also known as: St3gal5; 
RGD ID: 4898220
Expected Size: 127 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381870,425,237 - 70,425,349UniSTSGRCm38
GRCm38672,154,302 - 72,154,428UniSTSGRCm38
MGSCv371870,584,891 - 70,585,003UniSTSGRCm37
MGSCv37672,104,296 - 72,104,422UniSTSGRCm37
Celera1871,712,366 - 71,712,482UniSTS
Celera674,242,420 - 74,242,536UniSTS
Cytogenetic Map6C3UniSTS
cM Map6 UniSTS
cM MapUN UniSTS
Is Marker For: Genes:   St3gal5  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CCACACTTCCTACACTGTCA
Reverse Primer CACTTAGATGATTTGGAAGG
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:1930562 UniSTS
NCBI Gene 20454 UniSTS
UniSTS 209590 UniSTS