RH126708 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: RH126708

Symbol: RH126708
Also known as:
RGD ID: 4896299
Expected Size: 213 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm3810116,485,995 - 116,486,206UniSTSGRCm38
MGSCv3710115,923,051 - 115,923,262UniSTSGRCm37
Celera10118,427,575 - 118,427,786UniSTS
Cytogenetic Map10D2UniSTS
Whitehead/MRC_RH101312.23UniSTS
Is Marker For: Genes:   Cnot2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CAAAGTAGAGAAAACAAATTACAAATT
Reverse Primer CTTCTAAAAAGGCTTCCCTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1323254Cnot2CCR4-NOT transcription complex, subunit 210116485160116581900Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1302067Scc9_mcolon tumor susceptibility 9 (mouse)Not determined1018383585125739363Mouse
27226772Tibl13_mtibia length 13, 10 week (mouse)1019000000129800000Mouse
26884426Cvht1_mcranial vault height 1, 5 week (mouse)1024800000121200000Mouse
27095911Pglq15_mpelvic girdle length QTL 15, 16 week (mouse)1039300000129800000Mouse
27226764Tibl19_mtibia length 19, 16 week (mouse)1039300000129800000Mouse
26884407Bzwq14_mbi-zygomatic width QTL 14, 16 wee (mouse)1045600000120800000Mouse
26884450Sklq15_mskull length QTL 15, 16 week (mouse)1059500000122500000Mouse
13208560Wght9_mweight 9 (mouse)1060000000121000000Mouse
26884430Zlq5_mzygomatic length QTL 5, 10 week (mouse)1068000000125000000Mouse
26884405Huml2_mhumerus length 2, 5 week (mouse)1069900000132500000Mouse
11353832Pcholq4_mplasma cholesterol QTL 4 (mouse)1074151384125680038Mouse
11353843Gluq1_mblood glucose QTL 1 (mouse)1074151384125680038Mouse
10043881Adip24_madiposity 24 (mouse)Not determined1082556941116557090Mouse
4141054mwfh_mmodifier of white forlock hypopigmentation (mouse)Not determined83181141117181274Mouse
1357779Tesq3_mtestis weight QTL 3 (mouse)Not determined1084243786122205623Mouse
4141479W10q8_mweight 10 weeks QTL 8 (mouse)Not determined84243786122205623Mouse
4141387Lgaq5_mlate growth adjusted QTL 5 (mouse)Not determined84243786122205623Mouse
4142496W6q8_mweight 6 weeks QTL 8 (mouse)Not determined84243786122205623Mouse
4142365Egq9_mearly growth QTL 9 (mouse)Not determined84243786122205623Mouse
1357594Estoq3_membryo survival total QTL 3 (mouse)Not determined1084243786122205623Mouse
1357622Espq3_membryo survival preimplantation QTL 3 (mouse)Not determined1084243786122205623Mouse
1357638Cia29_mcollagen induced arthritis 29 (mouse)Not determined1085619118118661448Mouse
1300797Sluc22_msusceptibility to lung cancer 22 (mouse)Not determined1086877747120877895Mouse
1301520Uvbi1_mUVB induced immunosuppression 1 (mouse)Not determined1087073224121073368Mouse
1300908Insq4_minsulin QTL 4 (mouse)Not determined1087073224121073368Mouse
1300921Skl4_mskeletal size (tail length) 4 (mouse)Not determined1088252393122252530Mouse
4142386Tgq20_mtriglyceride QTL 20 (mouse)Not determined89000595123000595Mouse
1301758Fcsa3_mfemoral cross-sectional area 3 (mouse)Not determined1090091790124091893Mouse
11039516Ltpr5_mLeishmania tropica response 5 (mouse)1090671039125739363Mouse
13208554Lgth11_mbody length 11 (mouse)1091000000121000000Mouse
4142461Bmd25_mbone mineral density 25 (mouse)Not determined1097381196130694993Mouse
1357544Vtbt10_mvertebral trabecular bone trait 10 (mouse)Not determined1097381196130694993Mouse
11533919Mvb4_mmodifier of vibrator 4 (mouse)397381196130694993Mouse
11533921Mvb2_mmodifier of vibrator 2 (mouse)1097381196130694993Mouse
12880413V125Dq9_mvitamin D active form serum level QTL 9 (mouse)1097700000130694993Mouse
4141402T2dm1sa_mtype 2 diabetes mellitus 1 in SMXA RI mice (mouse)Not determined97922739130694993Mouse
11040593Lmr5e_mleishmaniasis resistance 5e (mouse)1099384730130694993Mouse
11040595Lmr5c_mleishmaniasis resistance 5c (mouse)1099384730130694993Mouse
11040597Lmr5a_mleishmaniasis resistance 5a (mouse)1099384730130694993Mouse
1301968Estq4_mestradiol regulated response QTL 4 (mouse)Not determined10101150611130694993Mouse
1357744Cfbw4_mcystic fibrosis body weight 4 (mouse)Not determined10101150611130694993Mouse
1301901Im5_mimmunoregulatory 5 (mouse)Not determined10101661259130694993Mouse
4141361Cfmq3_mcystic fibrosis modifier QTL 3 (mouse)Not determined10101661259130694993Mouse
1300678Leg2_mlongevity extending gene 2 (mouse)Not determined10102671003130694993Mouse
27226725Tibw1_mtibia width 1, proximal, 5 week (mouse)10102900000123400000Mouse
1301895Exq1_mexploratory and excitability QTL 1 (mouse)Not determined10103011947130694993Mouse
14696727Kidrq2_mkidney weight, right QTL 2 (mouse)10103066603130694993Mouse
4141007Obrq10_mobesity resistance QTL 10 (mouse)Not determined103407822130694993Mouse
4141487Tgq21_mtriglyceride QTL 21 (mouse)Not determined104274116130694993Mouse
14746996Manh69_mmandible shape 69 (mouse)10104927733130694993Mouse
1357482Nhdlq4_mnon-HDL QTL 4 (mouse)Not determined10105205399130694993Mouse
1300679Nociq2_mnociceptive sensitivity inflammatory QTL 2 (mouse)Not determined10105205399130694993Mouse
1302200Sle12_msystematic lupus erythematosus susceptibility 12 (mouse)Not determined10105205399130694993Mouse
4141269Ipng2_mimprinted postnatal growth 2 (mouse)Not determined105252393118661448Mouse
11040594Lmr5f_mleishmaniasis resistance 5f (mouse)10105343808130694993Mouse
11040596Lmr5d_mleishmaniasis resistance 5d (mouse)10105343808130694993Mouse
11040598Lmr5b_mleishmaniasis resistance 5b (mouse)10105343808130694993Mouse
4142089Obrq9_mobesity resistance QTL 9 (mouse)Not determined108680038130694993Mouse
4141153Ltgq2_mliver triglyceride QTL 2 (mouse)Not determined108680038130694993Mouse
11039496Ltpr5b_mLeishmania tropica response 5b (mouse)10108739225130694993Mouse
11041664Lmr25_mleishmaniasis resistance 25 (mouse)10108739225130694993Mouse
11049563Lmr25a_mleishmaniasis resistance 25a (mouse)10108739225130694993Mouse
11049570Lmr25b_mleishmaniasis resistance 25b (mouse)10108739225130694993Mouse
27226722Tibw7_mtibia width 7, proximal, 16 week (mouse)10108800000125600000Mouse
27095902Scvln11_msacral vertebrae length 2, 10 week (mouse)10110200000125600000Mouse
11353822Insq12_minsulin QTL 12 (mouse)10110617486125680038Mouse
11353823Homaq2_mhomeostatic model assessment QTL 2 (mouse)10110617486125680038Mouse
10412078Hylaq3_mHyperlocomotor activity related QTL 3 (mouse)Not determined10111732321118150744Mouse
26884391Skwq11_mskull length QTL 11, 16 week (mouse)10113700000121800000Mouse
26884433Zlq2_mzygomatic length QTL 2, 5 week (mouse)10113700000125900000Mouse
4141242Psrs2_mpsoriasis susceptibility 2 (mouse)Not determined10114381196118661448Mouse
26884383Bzwq3_mbi-zygomatic width QTL 3, 5 week (mouse)10114400000122900000Mouse
13506931Recrq11_mrecombination rate in male meiosis QTL 11 (mouse)10114500000123800000Mouse
26884377Skwq3_mskull length QTL 3, 5 week (mouse)10114800000122900000Mouse
1300796Lmr5_mleishmaniasis resistance 5 (mouse)Not determined10116384730122343923Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 72068 UniSTS
UniGene Mm.351553 UniSTS
UniSTS 208623 UniSTS