AU024348 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: AU024348

Symbol: AU024348
Also known as: 364405; 
RGD ID: 4895007
Expected Size: 90 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm38671,391,519 - 71,391,608UniSTSGRCm38
GRCm38541,730,446 - 41,730,536UniSTSGRCm38
MGSCv37671,341,513 - 71,341,602UniSTSGRCm37
MGSCv37542,121,685 - 42,121,775UniSTSGRCm37
Celera673,470,892 - 73,470,981UniSTS
Celera539,188,593 - 39,188,683UniSTS
Cytogenetic Map6C1UniSTS
Whitehead/MRC_RH6699.94UniSTS
Is Marker For: Genes:   Rmnd5a  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCCATCACCATGAAACTGAC
Reverse Primer CTAGGAGAGCCGGTATTTGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1320277Rmnd5arequired for meiotic nuclear division 5 homolog A67138863471440637Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
25440480Moaq2_mmodifier of alien QTL 2 (mouse)61117500000Mouse
26884414Bzwq12_mbi-zygomatic width QTL 12, 16 week (mouse)63400000139100000Mouse
1300556Cia6_mcollagen induced arthritis QTL 6 (mouse)Not determined6446488487426034Mouse
4142126W3q3_mweight 3 weeks QTL 3 (mouse)Not determined450382396656149Mouse
4142361W10q11_mweight 10 weeks QTL 11 (mouse)Not determined450382396656149Mouse
4142271Egq8_mearly growth QTL 8 (mouse)Not determined450382396656149Mouse
4142232W6q4_mweight 6 weeks QTL 4 (mouse)Not determined450382396656149Mouse
26884441Sklq3_mskull length QTL 3, 5 week (mouse)6760000080600000Mouse
1357442Dbts1_mdiabetes 1 (mouse)Not determined61823414873387692Mouse
13208564Bmiq7_mbody mass index QTL 7 (mouse)62500000080000000Mouse
4141782Mrdq5_mmodifier of retinal degeneration QTL 5 (mouse)Not determined3285065078238974Mouse
1558984Cplaq9_mcircadian period of locomotor activity 9 (mouse)Not determined63866962592607450Mouse
12880424V25Dq4_mvitamin D inactive form serum level QTL 4 (mouse)64160000075600000Mouse
1301266Lmr4_mleishmaniasis resistance 4 (mouse)Not determined64211637376116515Mouse
11040600Lmr4c_mleishmaniasis resistance 4c (mouse)64211637376116515Mouse
11040601Lmr4a_mleishmaniasis resistance 4a (mouse)64211637376116515Mouse
11533915Mts4_mmammary tumor susceptibility 4 (mouse)64211637376116515Mouse
12910785Pwgrq16_mpost-weaning growth rate QTL 16 (mouse)64382681377811523Mouse
12910798Pwgrq5_mpre-weaning growth rate QTL 5 (mouse)64382681377811523Mouse
12910802Pwbwq12_mpost-weaning body weight QTL 12 (mouse)64382681377811523Mouse
12910807Pwbwq11_mpost-weaning body weight QTL 11 (mouse)64382681377811523Mouse
12910809Pwbwq10_mpost-weaning body weight QTL 10 (mouse)64382681377811523Mouse
12910820Ogrq3_moverall growth rate QTL 3 (mouse)64382681377811523Mouse
1300618Pgia19_mproteoglycan induced arthritis 19 (mouse)Not determined64531405987426034Mouse
10412157Fl1n_mfatty liver 1 in NSY (mouse)Not determined645314059128835032Mouse
4142259Tabw2_mtally ho associated body weight 2 (mouse)Not determined46935985136423692Mouse
25314319Histh6_mhistamine hypersensitivity 6 (mouse)648720000125360000Mouse
25314320Histh5_mhistamine hypersensitivity 5 (mouse)648720000148450000Mouse
4140983Srilp_msleep response to influenza, light phase (mouse)Not determined4872655675447710Mouse
1301962Eila2_methanol induced locomotor activity 2 (mouse)Not determined648726556125356785Mouse
1301254Skts11_mskin tumor susceptibility 11 (mouse)Not determined65117915085179300Mouse
1357683Igf1sl1_mIGF-1 serum levels 1 (mouse)Not determined652161713116155267Mouse
4141028Mclr_mmethylcholanthrene lymphoma resistance (mouse)Not determined5437342788379171Mouse
15039373Adip28_madiposity 28 (mouse)65630821190308211Mouse
15039375Bw41_mbody weight QTL 41 (mouse)65630821190308211Mouse
1558977Skmw10_mskeletal muscle weight 10 (mouse)Not determined65844758392447710Mouse
10043972Obq28_mobesity QTL 28 (mouse)Not determined65854043392540433Mouse
1301740Bwq2_mbody weight QTL 2 (mouse)Not determined66005768094057799Mouse
1301369Im4_mimmunoregulatory 4 (mouse)Not determined66348473897484905Mouse
1300650Bw18_mbody weight QTL 18 (mouse)Not determined666713869100714031Mouse
1301876Bits2_mbitterness sensitivity 2 (mouse)Not determined670425898104426034Mouse
1301813Skl3_mskeletal size (tail length) 3 (mouse)Not determined670425898104426034Mouse
1301034Egrm2_mearly growth rate (mouse)Not determined670425898104426034Mouse
4141990Etax6_methanol induced ataxia 6 (mouse)Not determined7132262186275719Mouse
1302020Bbaa20_mB.burgdorferi-associated arthritis 20 (mouse)Not determined67132262193464093Mouse
4141207Imrfq1_mimmune response to Factor IX QTL 1 (mouse)Not determined5791911941919241Mouse
1301693Sle6_msystemic lupus erythematosus susceptibility 6 (mouse)Not determined5884069387693978Mouse
14696730Kidlq1_mkidney weight, left QTL 1 (mouse)51340580847405808Mouse
1301685Estq2_mestradiol regulated response QTL 2 (mouse)Not determined51547674049476846Mouse
1300719Iba5_minduction of brown adipocytes 5 (mouse)Not determined52052964954529790Mouse
1301776Skts3_mskin tumor susceptibility 3 (mouse)Not determined52150995255510060Mouse
11537368Hmtb10_mhemostasis and thrombosis 10 (mouse)52189582554342976Mouse
11537367Hmtb11_mhemostasis and thrombosis 11 (mouse)52189582564649236Mouse
11341716Rvfs3_mRift Valley fever susceptibility 3 (mouse)526236236138457140Mouse
1300701Cd8ts1_mCD8 T cell subset 1 (mouse)Not determined52705800661058109Mouse
1301555Alcp10_malcohol preference locus 10 (mouse)Not determined53086693364867138Mouse
1301403Alcp9_malcohol preference locus 9 (mouse)Not determined53086693364867138Mouse
11353827Hplq1_mhot plate latency 1 (mouse)53141311665413116Mouse
4140990Lgq6_mlate growth QTL 6 (mouse)Not determined31975890100630065Mouse
4141219W10q16_mweight 10 weeks QTL 16 (mouse)Not determined31975890100630065Mouse
10043995Hbnr9_mHeligmosomoides bakeri nematode resistance 9 (mouse)Not determined53333132567331534Mouse
1301845Lxw4_mlupus BXSB x NZW 4 (mouse)Not determined53553712069537252Mouse
11049558Lmr24b_mleishmaniasis resistance 24b (mouse)53553712069537252Mouse
11049559Lmr24c_mleishmaniasis resistance 24c (mouse)53553712069537252Mouse
11049561Lmr24e_mleishmaniasis resistance 24e (mouse)53553712069537252Mouse
1301223Hdlq7_mHDL QTL 7 (mouse)Not determined53569722669697372Mouse
13464252Ahl10_mage related hearing loss, early onset 10 (mouse)53569722669697372Mouse
4141647Hrvhf1_mheart rate variability, high frequency 1 (mouse)Not determined3627608170276081Mouse
1301170Lith13_mlithogenic gene 13 (mouse)Not determined53633714470337256Mouse
36049766Ars22_mantibody response to SARS-CoV 22, day 29, IgG3 (mouse)53680000045300000Mouse
36049767Ars23_mantibody response to SARS-CoV 23, day 29, Total IgG (mouse)53680000045300000Mouse
36049768Ars24_mantibody response to SARS-CoV 24, 4 days post-rechallenge, IgG3 (mouse)53680000045300000Mouse
36049769Ars13_mantibody response to SARS-CoV 13, day 7, IgG2a+IgG2c (mouse)53680000045300000Mouse
36049770Ars14_mantibody response to SARS-CoV 14, day 7, IgG3 (mouse)53680000045300000Mouse
36049771Ars15_mantibody response to SARS-CoV 15, day 7, IgM (mouse)53680000045300000Mouse
36049772Ars20_mantibody response to SARS-CoV 20, day 15, Total IgG (mouse)53680000045300000Mouse
36049773Ars21_mantibody response to SARS-CoV 21, day 29, IgG2a+IgG2c (mouse)53680000045300000Mouse
36049774Ars16_mantibody response to SARS-CoV 16, day 7, Total IgG (mouse)53680000045300000Mouse
36049775Ars17_mantibody response to SARS-CoV 17, day 15, IgG2a+IgG2c (mouse)53680000045300000Mouse
36049776Ars18_mantibody response to SARS-CoV 18, day 15, IgG3 (mouse)53680000045300000Mouse
36049777Ars19_mantibody response to SARS-CoV 19, day 15, IgM (mouse)53680000045300000Mouse
35673310Ari4_mantibody response to influenza 4, day 15-45, IgG2b (mouse)53680000045300000Mouse
1300926Hpi2_mhepatic PMN infiltration 2 (mouse)Not determined53742414464649236Mouse
1301524Lmb2_mlupus in MRL and B6 F2 cross (mouse)Not determined537424144112317856Mouse
13464246Ahl11_mage related hearing loss, early onset 11 (mouse)53748643571486554Mouse
1300951Gbvq1_mgallstone bladder volume QTL 1 (mouse)Not determined53795433971954456Mouse
13464245Ahl12_mage related hearing loss, early onset 12 (mouse)53795433971954456Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 68477 UniSTS
UniSTS 207974 UniSTS