Wnt3a Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: Wnt3a

Symbol: Wnt3a
Also known as:
RGD ID: 4892997
Expected Size: 544 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381159,249,104 - 59,249,647UniSTSGRCm38
MGSCv371159,062,606 - 59,063,149UniSTSGRCm37
Celera1164,014,105 - 64,014,648UniSTS
Cytogenetic Map11B1.3UniSTS
cM Map1132.0UniSTS
Is Marker For: Genes:   Wnt3a  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGCACACCTGCAAGTAGGA
Reverse Primer TCCAAAAGTTCCACCCAGTC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1317607Wnt3awingless-type MMTV integration site family, member 3A115924803659290751Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
27226798Scvln18_msacral vertebrae length 2, 16 week (mouse)11330000060800000Mouse
26884446Sklq10_mskull length QTL 10, 10 week (mouse)11330000063000000Mouse
26884453Sklq16_mskull length QTL 16, 16 week (mouse)11330000072800000Mouse
13208559Wght10_mweight 10 (mouse)11400000089000000Mouse
13208558Lgth12_mbody length 12 (mouse)11400000095000000Mouse
1300905Scc6_mcolon tumor susceptibility 6 (mouse)Not determined11693027789128908Mouse
27226738Metcl11_mmetatarsal-calcaneal length 11, 10 week (mouse)11890000061500000Mouse
26884401Huml4_mhumerus length 4, 10 week (mouse)111160000068600000Mouse
27226762Feml21_mfemur length 21, 16 week (mouse)111180000066100000Mouse
4141966Tailq1_mtail length QTL 1 (mouse)Not determined1231863768609504Mouse
1357851Scfq3_msubcutaneous fat pad weight QTL 3 (mouse)Not determined111231863768609504Mouse
1357437Epfq4_mepididymal fat pad weight QTL 4 (mouse)Not determined111231863768609504Mouse
4141127W3q4_mweight 3 weeks QTL 4 (mouse)Not determined1231863768609504Mouse
4142216Lgq1_mlate growth QTL 1 (mouse)Not determined1231863768609504Mouse
4142308W6q3_mweight 6 weeks QTL 3 (mouse)Not determined111231863768609504Mouse
4141582Lgaq1_mlate growth adjusted QTL 1 (mouse)Not determined1231863768609504Mouse
4142109W10q2_mweight 10 weeks QTL 2 (mouse)Not determined1231863768609504Mouse
4141470Egq4_mearly growth QTL 4 (mouse)Not determined1231863768609504Mouse
1357640Orq2_movulation rate QTL 2 (mouse)Not determined111231863768609504Mouse
1357720Kidpq1_mkidney weight percentage QTL 1 (mouse)Not determined111231863768609504Mouse
1559002Lmrq4_mLeishmania major resistance QTL 4 (mouse)Not determined111231863769794121Mouse
1357859Lvrq7_mliver weight QTL 7 (mouse)Not determined1112318637118131898Mouse
39128214Lwq20_mliver weight QTL 20 (mouse)1112318637118131898Mouse
1558945Orgwq8_morgan weight QTL 8 (mouse)Not determined111710617567187585Mouse
10053687Eae6_msusceptibility to experimental allergic encephalomyelitis 6 (mouse)Not determined111783196668609504Mouse
4141894Nidd6k_mNidd6 on KK-A (mouse)Not determined1917420497007000Mouse
10412246Dfs2_mdental fluorosis suseptibility 2 (mouse)Not determined112185736495990405Mouse
10044006Hbnr13_mHeligmosomoides bakeri nematode resistance 13 (mouse)Not determined112588179959881914Mouse
1357844Si5lq5_mserum IGFBP-5 level QTL 5 (mouse)Not determined112827504662275149Mouse
13524848Ppiq7_mprepulse inhibition QTL 7 (mouse)112867832062678320Mouse
1301426Desp2_mdespair 2 (mouse)Not determined112881775462817873Mouse
11522752Cocia18_mcocaine-induced activity, QTL 18 (mouse)113111738265117382Mouse
11059563Lmr31_mleishmaniasis resistance 31 (mouse)113220975066209867Mouse
1357782Char8_mP. chabaudi malaria resistance QTL 8 (mouse)Not determined113568778969794161Mouse
13208569Bmiq10_mbody mass index QTL 10 (mouse)113600000085000000Mouse
1301328Mol4_mmodifier of LPS-response 4 (mouse)Not determined113639175083590530Mouse
1301788Lbw8_mlupus NZB x NZW 8 (mouse)Not determined113661246070618665Mouse
1301896Tria1_mT-cell receptor induced activation 1 (mouse)Not determined113672273870723028Mouse
4141853Skmw17_mskeletal muscle weight 17 (mouse)Not determined113719011571190238Mouse
4142475Ity2a_mimmunity to S. typhimurium 2a (mouse)Not determined113787775360511890Mouse
10766457Nwa3_mNew Zealand White autoimmunity 3 (mouse)113812528972125383Mouse
11532698Sluc36a_msusceptibility to lung cancer 36a (mouse)114236579176365904Mouse
11532699Sluc36b_msusceptibility to lung cancer 36b (mouse)114236579176365904Mouse
4142300Ctrq3_mC. trachomatis resistance QTL 3 (mouse)Not determined114473921176963931Mouse
4141367Inf1_macute ozone induced inflammation (mouse)Not determined44739211113167183Mouse
4141000Nidd3_mnon-insulin-dependent diabetes mellitus 3 (mouse)Not determined4515120179151308Mouse
1302021Nidd1n_mnon-insulin-dependent diabetes mellitus 1 in NSY (mouse)Not determined114527504680087498Mouse
1357878Mastr_mmodifier of astrocytoma (mouse)Not determined114581775489927907Mouse
1300765Bbaa4_mB.burgdorferi-associated arthritis 4 (mouse)Not determined114629434180294436Mouse
1301988Bmd11_mbone mineral density 11 (mouse)Not determined114642858180428696Mouse
1301830Ssta4_msusceptibility to Salmonella typhimurium antigens 4 (mouse)Not determined115018736584187585Mouse
13524840Ppiq9a_mprepulse inhibition QTL 9a (mouse)115260355986603559Mouse
1300774Pgia7_mproteoglycan induced arthritis 7 (mouse)Not determined115349976287499911Mouse
4141084Spqq1_msperm quality QTL 1 (mouse)Not determined5417484463428696Mouse
1302186Blmpf2_mbleomycin-induced pulmonary fibrosis 2 (mouse)Not determined115417484467187585Mouse
4142148Ckdbp2_mchronic kidney disease blood pressure locus 2 (mouse)Not determined115419011565213015Mouse
4141830Pregq1_mpregnancy QTL 1 (mouse)Not determined115423592683842826Mouse
4141875Etax9_methanol induced ataxia 9 (mouse)Not determined5539415972319101Mouse
4142121Tmc1m2_mTmc1 modifier 2 (mouse)Not determined1156973201114267131Mouse
1300664Etohcta9_methanol conditioned taste aversion 9 (mouse)Not determined115786383491863932Mouse
10053682Eae45_mexperimental allergic encephalomyelitis susceptibility 45 (mouse)Not determined115859972974863932Mouse
1300924Ity2_mimmunity to S. typhimurium 2 (mouse)Not determined15861720487804412Mouse
4141982Skts-fp2_mskin tumor susceptibility in FVB and PWK 2 (mouse)Not determined5882844085175703Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:4367811 UniSTS
NCBI Gene 22416 UniSTS
UniSTS 527138 UniSTS