DXGot42 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXGot42

Symbol: DXGot42
Previously known as: OT89.27; oxsts2810; 
RGD ID: 45739
Expected Size: 175 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X39,194,190 - 39,194,365 (+)MAPPERmRatBN7.2
Rnor_6.0X42,059,892 - 42,060,066NCBIRnor6.0
Rnor_5.0X42,366,142 - 42,366,316UniSTSRnor5.0
RGSC_v3.4X60,578,735 - 60,578,910RGDRGSC3.4
RGSC_v3.4X60,578,736 - 60,578,910UniSTSRGSC3.4
RGSC_v3.1X60,632,205 - 60,632,379RGD
CeleraX39,798,221 - 39,798,368UniSTS
RH 3.4 MapX549.1UniSTS
RH 3.4 MapX549.1RGD
RH 2.0 Map21436.8RGD


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GATTAACACCCCCACACACA
Reverse Primer GAATGGAATACCCAGACTATTCAAA
 

Region

Nucleotide Sequences
GenBank Nucleotide AU026732 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X143491017Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1529780260297802Rat
1598873Memor2Memory QTL 22.5exploratory behavior trait (VT:0010471)average horizontal distance between subject and target during voluntary locomotion in an experimental apparatus (CMO:0002674)X2099094741052531Rat
2290375Gluco34Glucose level QTL 342.75blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X2099094741203591Rat


Additional Information

Database Acc Id Source(s)
UniSTS 113991 UniSTS