DXWox2 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXWox2

Symbol: DXWox2
Also known as: R323; oxsts5777; 
RGD ID: 45715
Expected Size: 330 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X14,843,113 - 14,843,484 (+)MAPPERmRatBN7.2
Rnor_6.0X15,688,119 - 15,688,489NCBIRnor6.0
Rnor_5.0X16,479,345 - 16,479,715UniSTSRnor5.0
RGSC_v3.4X26,883,972 - 26,884,343RGDRGSC3.4
RGSC_v3.4X26,883,973 - 26,884,343UniSTSRGSC3.4
RGSC_v3.1X26,937,442 - 26,937,812RGD
CeleraX14,926,447 - 14,926,817UniSTS
RH 3.4 MapX166.2UniSTS
RH 3.4 MapX166.2RGD
RH 2.0 Map21112.6RGD
Cytogenetic MapXq13UniSTS
Is Marker For: QTLs:   Cia18  
Genes:   Prickle3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TGCTGGAATTACAGGTCTGC
Reverse Primer TCAAGCTCCAGGCTCCAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1359685Prickle3prickle planar cell polarity protein 3X1483764714849305Rat

Nucleotide Sequences
GenBank Nucleotide CH474078 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X143491017Rat
634325Bw13Body weight QTL 130body mass (VT:0001259)body weight (CMO:0000012)X144797220991088Rat
70165Bp64Blood pressure QTL 645.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X144812931706553Rat
631204Gluco15Glucose level QTL 150.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X162371522646544Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 317380 UniSTS
  326438 UniSTS
UniSTS 118080 UniSTS