Marker: D20Got47 |
Symbol: |
D20Got47 |
Previously known as: |
OT78.30; oxsts1650;
|
RGD ID: |
45706 |
Expected Size: |
204 (bp) |
Position |
Rat Assembly | Chr | Position (strand) | Source | JBrowse |
---|
mRatBN7.2 | 20 | 49,218,496 - 49,218,702 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 20 | 50,847,540 - 50,847,745 | NCBI | Rnor6.0 | Rnor_5.0 | 20 | 52,461,119 - 52,461,324 | UniSTS | Rnor5.0 | RGSC_v3.4 | 20 | 50,043,376 - 50,043,581 | UniSTS | RGSC3.4 | RGSC_v3.4 | 20 | 50,043,375 - 50,043,581 | RGD | RGSC3.4 | RGSC_v3.1 | 20 | 50,072,073 - 50,072,278 | RGD | | Celera | 20 | 50,821,579 - 50,821,784 | UniSTS | | RH 3.4 Map | 20 | 506.8 | UniSTS | | RH 3.4 Map | 20 | 506.8 | RGD | | RH 2.0 Map | 20 | 618.1 | RGD | |
|
Annotation
References - curated
# |
Reference Title |
Reference Citation |
1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
3. |
UniSTS Pipeline |
RGD automated pipelines
|
4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
|
Forward Primer |
CATGGATATGGTCTGCTCCTT |
Reverse Primer |
GGATTCTTGTCACTGTAACAGACG |
|
Region
QTLs in Region (mRatBN7.2)
7411652 | Foco24 | Food consumption QTL 24 | | 0.001 | eating behavior trait (VT:0001431) | feed conversion ratio (CMO:0001312) | 20 | 11757515 | 54435887 | Rat | 9590092 | Insglur9 | Insulin/glucose ratio QTL 9 | 18.38 | 0.001 | blood insulin amount (VT:0001560) | calculated plasma insulin level (CMO:0002170) | 20 | 11757515 | 54435887 | Rat | 2317880 | Alcrsp25 | Alcohol response QTL 25 | 2.3 | | response to alcohol trait (VT:0010489) | duration of loss of righting reflex (CMO:0002289) | 20 | 17697550 | 54435887 | Rat | 2303626 | Vencon10 | Ventilatory control QTL 10 | | 0.001 | respiration trait (VT:0001943) | respiration rate (CMO:0000289) | 20 | 19190721 | 54435887 | Rat | 2303578 | Gluco50 | Glucose level QTL 50 | 2 | | blood glucose amount (VT:0000188) | blood glucose level (CMO:0000046) | 20 | 25106722 | 54435887 | Rat | 2303587 | Bw93 | Body weight QTL 93 | 13 | | body mass (VT:0001259) | body weight (CMO:0000012) | 20 | 25106722 | 54435887 | Rat | 2300188 | Bmd68 | Bone mineral density QTL 68 | 6.4 | 0.0001 | femur mineral mass (VT:0010011) | volumetric bone mineral density (CMO:0001553) | 20 | 25106722 | 54435887 | Rat | 1331747 | Hrtrt16 | Heart rate QTL 16 | 3.163 | | heart pumping trait (VT:2000009) | heart rate (CMO:0000002) | 20 | 25209734 | 54435887 | Rat | 1598869 | Memor6 | Memory QTL 6 | 3.1 | | exploratory behavior trait (VT:0010471) | total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443) | 20 | 29244388 | 54435887 | Rat | |
Additional Information
External Database Links
Database |
Acc Id |
Source(s) |
UniSTS |
113193 |
UniSTS |
|
|