D19Got37 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D19Got37

Symbol: D19Got37
Previously known as: OT03.16; oxsts1495; 
RGD ID: 45642
Expected Size: 321 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21943,355,765 - 43,356,080 (+)MAPPERmRatBN7.2
Rnor_6.01947,690,741 - 47,691,055NCBIRnor6.0
Rnor_5.01958,498,502 - 58,498,816UniSTSRnor5.0
RGSC_v3.41945,487,437 - 45,487,752RGDRGSC3.4
RGSC_v3.41945,487,438 - 45,487,752UniSTSRGSC3.4
RGSC_v3.11945,492,319 - 45,492,633RGD
Celera1942,661,321 - 42,661,635UniSTS
RH 3.4 Map19584.6UniSTS
RH 3.4 Map19584.6RGD
RH 2.0 Map19607.4RGD
Cytogenetic Map19q12UniSTS
Is Marker For: Genes:   Wwox  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer GTAACAACCGATGGCACAGT
Reverse Primer ACCCATTGACATATGAATTCTGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3034MafMAF bZIP transcription factor194335386743713162Rat
1309927WwoxWW domain-containing oxidoreductase194243214143360278Rat

Nucleotide Sequences
GenBank Nucleotide AU029036 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2317848Alcrsp21Alcohol response QTL 211.8999999761581420.05response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)19320477748204777Rat
9589102Slep13Serum leptin concentration QTL 134.630.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)1956937445569374Rat
7247442Uae39Urinary albumin excretion QTL 39urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)19218792746708701Rat
8694186Bw152Body weight QTL 1523.340.001body mass (VT:0001259)body weight gain (CMO:0000420)1956937445569374Rat
7411549Bw130Body weight QTL 13050.001body mass (VT:0001259)body weight gain (CMO:0000420)191545586057337602Rat
1331737Uae29Urinary albumin excretion QTL 295.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19409615555283277Rat
1331788Rf45Renal function QTL 452.818kidney blood vessel physiology trait (VT:0100012)absolute change in renal blood flow rate (CMO:0001168)191560502346559041Rat
1578764Stresp19Stress response QTL 193.60.001blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)191563020157337602Rat
61423Cia14Collagen induced arthritis QTL 143joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)191082797043544039Rat
61447Tcas1Tongue tumor susceptibility QTL 16.08tongue integrity trait (VT:0010553)squamous cell carcinoma of the tongue maximum tumor diameter (CMO:0001875)19231612147316121Rat
724566Uae12Urinary albumin excretion QTL 125urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)19218792756457239Rat
2298478Eau8Experimental allergic uveoretinitis QTL 80.0163uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)191715443357337602Rat
61350Bp32Blood pressure QTL 320.012arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)192048357557337602Rat
724546Kidm3Kidney mass QTL 33.1kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)192932249057337602Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum insulin level (CMO:0000358)193383821455283146Rat
1358200Insglur2Insulin/glucose ratio QTL 24.1blood glucose amount (VT:0000188)serum glucose level (CMO:0000543)193383821455283146Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 292041 UniSTS
UniSTS 111756 UniSTS