Marker: D14Got75 |
| Symbol: |
D14Got75 |
| Previously known as: |
OT77.44; oxsts1081;
|
| RGD ID: |
45214 |
| Expected Size: |
223 (bp) |
| Position |
| Rat Assembly | Chr | Position (strand) | Source | JBrowse |
|---|
mRatBN7.2 | 14 | 96,983,122 - 96,983,345 (+) | MAPPER | mRatBN7.2 | Rnor_6.0 | 14 | 107,758,662 - 107,758,884 | NCBI | Rnor6.0 | Rnor_5.0 | 14 | 107,834,681 - 107,834,903 | UniSTS | Rnor5.0 | RGSC_v3.4 | 14 | 103,666,379 - 103,666,602 | RGD | RGSC3.4 | RGSC_v3.4 | 14 | 103,666,380 - 103,666,602 | UniSTS | RGSC3.4 | RGSC_v3.1 | 14 | 103,685,591 - 103,685,813 | RGD | | Celera | 14 | 95,964,403 - 95,964,625 | UniSTS | | RH 3.4 Map | 14 | 777.6 | UniSTS | | RH 3.4 Map | 14 | 777.6 | RGD | | RH 2.0 Map | 14 | 845.0 | RGD | | Cytogenetic Map | 14 | q22 | UniSTS | |
|
| Is Marker For: |
Genes:
Commd1
|
Annotation
References - curated
| # |
Reference Title |
Reference Citation |
| 1. |
Data downloaded from Wellcome Trust, University of Oxford |
Data downloaded from Wellcome Trust, University of Oxford
|
| 2. |
High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. |
Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
|
| 3. |
UniSTS Pipeline |
RGD automated pipelines
|
| 4. |
RH Map Project |
RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
|
| 5. |
A high density integrated genetic linkage and radiation hybrid map of the laboratory rat |
Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
|
Strains and Sequence
Sequence
| |
| Forward Primer |
CTCTCTAGTCCCCTCAACCCC |
| Reverse Primer |
GATCTCTGGAGTTCCTGGCTG |
| |
Region
Genes in Region
| 1311771 | Commd1 | copper metabolism domain containing 1 | 14 | 96880463 | 96984494 | Rat | |
QTLs in Region (mRatBN7.2)
| 631523 | Pia13 | Pristane induced arthritis QTL 13 | 3.3 | | joint integrity trait (VT:0010548) | joint inflammation composite score (CMO:0000919) | 14 | 40793460 | 98037301 | Rat | | 2300197 | Scl59 | Serum cholesterol level QTL 59 | | | blood cholesterol amount (VT:0000180) | serum total cholesterol level (CMO:0000363) | 14 | 55147478 | 100147478 | Rat | | 9590294 | Uminl4 | Urine mineral level QTL 4 | 5.66 | 0.001 | urine mineral amount (VT:0015086) | urine electrolyte level (CMO:0000593) | 14 | 55624247 | 100624247 | Rat | | 9589034 | Epfw11 | Epididymal fat weight QTL 11 | 6 | 0.001 | epididymal fat pad mass (VT:0010421) | epididymal fat pad weight to body weight ratio (CMO:0000658) | 14 | 55624247 | 100624247 | Rat | | 2317879 | Alcrsp27 | Alcohol response QTL 27 | 3.3 | 0.63 | response to alcohol trait (VT:0010489) | duration of loss of righting reflex (CMO:0002289) | 14 | 56631369 | 101631369 | Rat | | 634328 | Hc5 | Hypercalciuria QTL 5 | 2.3 | | urine calcium amount (VT:0002985) | urine calcium excretion rate (CMO:0000763) | 14 | 58184885 | 103184885 | Rat | | 1582259 | Gluco23 | Glucose level QTL 23 | 3.1 | 0.0008 | blood glucose amount (VT:0000188) | blood glucose level area under curve (AUC) (CMO:0000350) | 14 | 70053989 | 104886043 | Rat | | 1641900 | Alcrsp11 | Alcohol response QTL 11 | | | alcohol metabolism trait (VT:0015089) | blood ethanol level (CMO:0000535) | 14 | 70053989 | 104886043 | Rat | |
