D13Got77 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D13Got77

Symbol: D13Got77
Previously known as: OT75.10; oxsts1003; 
RGD ID: 45092
Expected Size: 187 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01392,845,528 - 92,845,714NCBIRnor6.0
Rnor_5.01397,310,645 - 97,310,831UniSTSRnor5.0
RGSC_v3.41390,480,373 - 90,480,560RGDRGSC3.4
RGSC_v3.41390,480,374 - 90,480,560UniSTSRGSC3.4
RGSC_v3.11390,669,258 - 90,669,444RGD
Celera1386,331,162 - 86,331,348UniSTS
RH 3.4 Map13575.6UniSTS
RH 3.4 Map13575.6RGD
RH 2.0 Map13637.2RGD
Cytogenetic Map13q24UniSTS
Is Marker For: Genes:   Fmn2   Fmn2  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer AGTAATGGTCACTCCCCCCA
Reverse Primer TGACTGCTTGGAAGAATGGT
 

Region

Nucleotide Sequences
GenBank Nucleotide AU028393 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100360457 UniSTS
  289262 UniSTS
UniSTS 112371 UniSTS