D9Wox19 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Wox19

Symbol: D9Wox19
Also known as: D9R7Wox9; D7Wox9; RCA18.14; oxsts5317; 
RGD ID: 44567
Expected Size: 156 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2922,071,169 - 22,071,345 (+)MAPPER
Rnor_6.0925,692,342 - 25,692,517NCBIRnor6.0
Rnor_5.0924,554,173 - 24,554,348UniSTSRnor5.0
RGSC_v3.4918,347,568 - 18,347,743UniSTSRGSC3.4
RGSC_v3.4918,347,567 - 18,347,743RGDRGSC3.4
RGSC_v3.1918,344,890 - 18,345,065RGD
Celera919,655,621 - 19,655,796UniSTS
RH 3.4 Map9194.1UniSTS
RH 3.4 Map9194.1RGD
RH 2.0 Map9162.0RGD
Cytogenetic Map9 RGD
Is Marker For: QTLs:   Niddm26   Ciaa3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GGTGCACATTTGTGATTCTAGC
Reverse Primer GTGAAAATTCCTTGTCTTCTACC
 

Region



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
70226Eae4Experimental allergic encephalomyelitis QTL 4nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)9129467098Rat
9589055Scfw5Subcutaneous fat weight QTL 55.550.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)9140383872Rat
9589158Gluco65Glucose level QTL 656.820.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)9140383872Rat
7411592Foco8Food consumption QTL 87.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)9140383872Rat
1300124Cm4Cardiac mass QTL 43.55heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)9145029794Rat
10054125Srcrt7Stress Responsive Cort QTL 73.330.0011blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)9105522293442944Rat
1298088Edpm11Estrogen-dependent pituitary mass QTL 112.5pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)9235572247355722Rat
1641911Alcrsp13Alcohol response QTL 13response to alcohol trait (VT:0010489)brain neurotensin receptor 1 density (CMO:0002068)9235572247355722Rat
61425Cia15Collagen induced arthritis QTL 154.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)9288097747375681Rat
631211Bw4Body weight QTL45.31retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)9288097747880977Rat
1354650Despr5Despair related QTL 54.010.0017locomotor behavior trait (VT:0001392)amount of time spent in voluntary immobility (CMO:0001043)9498609549986095Rat
2303559Gluco54Glucose level QTL 542blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)9498609549986095Rat
61450Ciaa3CIA Autoantibody QTL 36.5blood autoantibody amount (VT:0003725)calculated serum anti-type 2 collagen antibody titer (CMO:0001279)9572425425692342Rat
11353947Bp392Blood pressure QTL 392arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)91221677157216771Rat
9589133Insul26Insulin level QTL 2617.960.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)91242546357425463Rat
7411609Foco16Food consumption QTL 1625.60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)91242546357425463Rat
1600365Mcs20Mammary carcinoma susceptibility QTL 203mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)91555490147249201Rat
724543Cm20Cardiac mass QTL 203.9heart mass (VT:0007028)calculated heart weight (CMO:0000073)91952048945029794Rat
631680Cm11Cardiac mass QTL 113.10.00089heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)92488509969885099Rat
70186Niddm26Non-insulin dependent diabetes mellitus QTL 263.87blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)92569234292741406Rat
631643Bp120Blood pressure QTL 12030.004arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)92569237370692373Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 326452 UniSTS
  326512 UniSTS
UniSTS 118020 UniSTS