D9Wox21 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D9Wox21

Symbol: D9Wox21
Also known as: RCA14.38; D9R7Wox7; D7Wox7; oxsts5319; 
RGD ID: 44552
Expected Size: 136 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2134,842,145 - 4,842,193 (+)MAPPERmRatBN7.2
mRatBN7.279,868,154 - 9,868,211 (+)MAPPERmRatBN7.2
mRatBN7.27210,555 - 210,607 (+)MAPPERmRatBN7.2
mRatBN7.2712,525,561 - 12,525,613 (+)MAPPERmRatBN7.2
mRatBN7.25109,552,936 - 109,552,993 (+)MAPPERmRatBN7.2
mRatBN7.21145,504,425 - 145,504,482 (-)MAPPERmRatBN7.2
mRatBN7.21371,745,684 - 71,745,742 (-)MAPPERmRatBN7.2
mRatBN7.21588,874,940 - 88,874,993 (-)MAPPERmRatBN7.2
mRatBN7.222,572,185 - 2,572,237 (-)MAPPERmRatBN7.2
mRatBN7.2279,190,419 - 79,190,476 (-)MAPPERmRatBN7.2
mRatBN7.2271,968,105 - 71,968,162 (-)MAPPERmRatBN7.2
mRatBN7.259,884,216 - 9,884,268 (-)MAPPERmRatBN7.2
mRatBN7.26134,955,777 - 134,955,834 (-)MAPPERmRatBN7.2
mRatBN7.2967,509,023 - 67,509,080 (-)MAPPERmRatBN7.2
mRatBN7.2X73,108,012 - 73,108,063 (-)MAPPERmRatBN7.2
mRatBN7.2X136,827,745 - 136,827,802 (-)MAPPERmRatBN7.2
mRatBN7.2813,304,202 - 13,304,261 (+)MAPPERmRatBN7.2
mRatBN7.21337,752,933 - 37,752,990 (+)MAPPERmRatBN7.2
mRatBN7.21451,129,417 - 51,129,474 (+)MAPPERmRatBN7.2
mRatBN7.21588,730,426 - 88,730,477 (+)MAPPERmRatBN7.2
mRatBN7.21566,417,978 - 66,418,033 (+)MAPPERmRatBN7.2
mRatBN7.21549,295,775 - 49,295,829 (+)MAPPERmRatBN7.2
mRatBN7.21622,661,352 - 22,661,409 (+)MAPPERmRatBN7.2
mRatBN7.223,230,484 - 3,230,536 (+)MAPPERmRatBN7.2
mRatBN7.2250,389,649 - 50,389,703 (+)MAPPERmRatBN7.2
mRatBN7.2237,405,653 - 37,405,710 (+)MAPPERmRatBN7.2
mRatBN7.2341,757,261 - 41,757,340 (+)MAPPERmRatBN7.2
mRatBN7.25126,986,761 - 126,986,815 (+)MAPPERmRatBN7.2
mRatBN7.25125,373,973 - 125,374,029 (+)MAPPERmRatBN7.2
Rnor_6.0915,509,178 - 15,509,311NCBIRnor6.0
RH 3.4 Map946.8UniSTS
RH 3.4 Map946.8RGD
RH 2.0 Map948.0RGD
Cytogenetic Map9 RGD
Is Marker For: QTLs:   Cdexp1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CGGAAAGGGAATAACAATCG
Reverse Primer CACGAGCATGGTGCATACAC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
619895Dlg2discs large MAGUK scaffold protein 21144451653146503949Rat
41025307LOC120097343uncharacterized LOC1200973431145498645145531228Rat
3309Pfkfb26-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2134214747342174699Rat
68957Qsox1quiescin sulfhydryl oxidase 1136794978067987434Rat
3561Rgs1regulator of G-protein signaling 1135601852956022939Rat
3862Timm17atranslocase of inner mitochondrial membrane 17A134673111746742604Rat
62388Htr5b5-hydroxytryptamine (serotonin) receptor 5B133268691132699835Rat
67366Pla2g4aphospholipase A2 group IVA136187781862022261Rat
2235C4bpacomplement component 4 binding protein, alpha134207571542111205Rat
2246Cacna1ecalcium voltage-gated channel subunit alpha1 E136657465967063443Rat
69252Ier5immediate early response 5136727013467272226Rat
70983Cacna1scalcium voltage-gated channel subunit alpha1 S134749394947564194Rat
61967Mcm6minichromosome maintenance complex component 6133982674539851937Rat
69342Serpinb5serpin family B member 5132298555723005756Rat
620055Ppfia4PTPRF interacting protein alpha 4134575382745802305Rat
3882Tnnt2troponin T2, cardiac type134726732547285390Rat
2048Adora1adenosine A1 receptor134565887245695821Rat
2710Glulglutamate-ammonia ligase136596906466035121Rat
62053Csrp1cysteine and glycine-rich protein 1134715817147179388Rat
621665Rgs2regulator of G-protein signaling 2135579974955802354Rat
628851Tor1aip1torsin 1A interacting protein 1136819668168226121Rat
628853Serpinb10serpin family B member 10132355334823571182Rat
620287Mybphmyosin binding protein H134565315645660893Rat
71088Niban1niban apoptosis regulator 1136367424063827748Rat
708462Nifknucleolar protein interacting with the FHA domain of MKI67132939330329403387Rat
727846Zp3rzona pellucida 3 receptor134201999842064836Rat
727850Kiss1KiSS-1 metastasis-suppressor134477482344780707Rat
620651Cd55CD55 molecule (Cromer blood group)134185724241885966Rat
727933Rnaselribonuclease L136589499065910354Rat
2446Ctsecathepsin E134309195443114509Rat
2886Il10interleukin 10134247262542477308Rat
621167Dars1aspartyl-tRNA synthetase 1133985793639913055Rat
621123Ptprvprotein tyrosine phosphatase, receptor type, V134654812546569148Rat
628835Gpr37l1G protein-coupled receptor 37-like 1134659857446605421Rat
3804Syt2synaptotagmin 2134608804646197976Rat
3821Cntn2contactin 2134394286843975973Rat
708516Ptpn7protein tyrosine phosphatase, non-receptor type 7134657090446584048Rat
628689Tmem37transmembrane protein 37133118432231191477Rat
628717Klhl12kelch-like family member 12134589991345933648Rat
621162Cep350centrosomal protein 350136802332768164478Rat
621308Phlpp1PH domain and leucine rich repeat protein phosphatase 1132230853222530978Rat
2490Dbidiazepam binding inhibitor, acyl-CoA binding protein133124146631249853Rat
620461Nphs2NPHS2 stomatin family member, podocin136844872068461312Rat
620465Cxcr4C-X-C motif chemokine receptor 4134007797640081883Rat
708421Brinp3BMP/retinoic acid inducible neural specific 3135841388358846828Rat
71063Serpinb7serpin family B member 7132336983023442205Rat
621641Soat1sterol O-acyltransferase 1136855227468597529Rat
621107Tsntranslin132936640529377251Rat
621823Serpinb2serpin family B member 2132353731223551823Rat
621658Sec16bSEC16 homolog B, endoplasmic reticulum export factor136966575769727199Rat
621694Rassf5Ras association domain family member 5134263751342703024Rat
631417Insig2insulin induced gene 2133247239032500139Rat
2913Inhbbinhibin subunit beta B133053086030536566Rat
620993Nucks1nuclear casein kinase and cyclin-dependent kinase substrate 1134334509143374316Rat
68353Nr5a2nuclear receptor subfamily 5, group A, member 2134831363448433494Rat
621137Rnpeparginyl aminopeptidase134669945846717829Rat
727956Lhx9LIM homeobox 9135038905250409947Rat
620428Cfhcomplement factor H135151237651613829Rat
620432Myogmyogenin134574545545748044Rat
621484Il24interleukin 24134235308942358487Rat
621765Tnni1troponin I1, slow skeletal type134722921747241640Rat
620911Nfascneurofascin134399722344183863Rat
1304916Optcopticin134535395445368254Rat
620712Ptpn4protein tyrosine phosphatase, non-receptor type 4133077201230952340Rat
708552Steap3STEAP3 metalloreductase133135195431397344Rat
619852RalbRAS like proto-oncogene B133058803630624199Rat
3277Pdcphosducin136229728162371754Rat
621342Sctrsecretin receptor133112778131190162Rat
735051Dstykdual serine/threonine and tyrosine protein kinase134385726643905280Rat
735059Tor1aip2torsin 1A interacting protein 2136822522668256536Rat
2236C4bpbcomplement component 4 binding protein, beta134212079842131515Rat
621305Atp2b4ATPase plasma membrane Ca2+ transporting 4134515613745255292Rat
61915Stx6syntaxin 6136733232967378580Rat
620349Ptgs2prostaglandin-endoperoxide synthase 2136216408062169770Rat
620868Acmsdaminocarboxymuconate semialdehyde decarboxylase133920048639244337Rat
735067Rgsl2hregulator of G-protein signaling like 2 homolog (mouse)136597369565974702Rat
620874Chi3l1chitinase 3 like 1134564180245649787Rat
71024Actr3actin related protein 3133680073936843837Rat
620226Prelpproline and arginine rich end leucine rich repeat protein134536840745391480Rat
620823Lctlactase133978192939824456Rat
631362Mapkapk2MAPK activated protein kinase 2134251376242560061Rat
1304635Atp6v1g3ATPase H+ transporting V1 subunit G3134980025649825247Rat
2199Bcl2BCL2, apoptosis regulator132268978322853920Rat
1304661Serpinb13serpin family B member 13132311858423150760Rat
735074Kcnt2potassium sodium-activated channel subfamily T member 2135166412952059209Rat
621052Lamc1laminin subunit gamma 1136537437265501492Rat
621053Lamc2laminin subunit gamma 2136528466465344200Rat
3571Rgs8regulator of G-protein signaling 8136580470365848953Rat
620892Rab29RAB29, member RAS oncogene family134330775743313420Rat
1307235RelchRAB11 binding and LisH domain, coiled-coil and HEAT repeat containing132180697221902807Rat
1307236Lmod1leiomodin 1134675404846796186Rat
1305532Rbbp5RB binding protein 5, histone lysine methyltransferase complex subunit134391225443939107Rat
727799Astn1astrotactin 1137053742370855440Rat
1305083Ro60Ro60, Y RNA binding protein135549951455520504Rat
1304702Colgalt2collagen beta(1-O)galactosyltransferase 2136452364164628295Rat
3328Pigrpolymeric immunoglobulin receptor134229890542326877Rat
3554Renrenin134479626044807491Rat
1306084Cyb5r1cytochrome b5 reductase 1134584901745855458Rat
2225Btg2BTG anti-proliferation factor 2134553188145535642Rat
1305132Klhdc8akelch domain containing 8A134373570243744277Rat
1307497R3hdm1R3H domain containing 1133959584839733876Rat
1305438Cdh20cadherin 20132073764021069746Rat
1308548Dhx9DExH-box helicase 9136560232265639098Rat
1305646Chit1chitinase 1134556584145613593Rat
1307078Tdrd5tudor domain containing 5136839418068447745Rat
1306745Gpr39G protein-coupled receptor 39133711525837327312Rat
1307331Nmnat2nicotinamide nucleotide adenylyltransferase 2136510595065277350Rat
1306206Kif21bkinesin family member 21B134757614247626112Rat
3451Ptprcprotein tyrosine phosphatase, receptor type, C134959619349708283Rat
1306290Ivns1abpinfluenza virus NS1A binding protein136342704063446701Rat
1306427Dpp10dipeptidyl peptidase like 10133458442036269619Rat
1307169Cdh19cadherin 19132793591528047490Rat
1307451Ubxn4UBX domain protein 4133974007739772347Rat
1305139Zfp281zinc finger protein 281134809610348104265Rat
1306541Pik3c2bphosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta134449467344555663Rat
1306554Xpr1xenotropic and polytropic retrovirus receptor 1136744120567585950Rat
1304773Cop1COP1, E3 ubiquitin ligase137146716471561826Rat
1307566Rasal2RAS protein activator like 2136927988269568647Rat
1307775Kdsr3-ketodihydrosphingosine reductase132286211722894118Rat
1304622RGD1304622similar to 6820428L09 protein136738891667427392Rat
1305030Acbd6acyl-CoA binding domain containing 6136772678667863392Rat
1307782RGD1307782similar to Williams-Beuren syndrome critical region protein 27134828454548285459Rat
1305251Rnf152ring finger protein 152132132403921403405Rat
1305414Uchl5ubiquitin C-terminal hydrolase L5135552072255556503Rat
1305609Shcbp1lSHC binding and spindle associated 1 like136556886365599155Rat
1309270Gli2GLI family zinc finger 2132994680930163901Rat
1311611Gpr25G protein-coupled receptor 25134770969647715270Rat
1308947Rgl1ral guanine nucleotide dissociation stimulator,-like 1136463448964904170Rat
1308441Dennd1bDENN domain containing 1B135054532450772922Rat
1307950Glrx2glutaredoxin 2135548187555504737Rat
1310504Elk4ETS transcription factor ELK4134345113043475035Rat
1310510Cfhr1complement factor H-related 1135139558351410571Rat
1559812Cntnap5acontactin associated protein-like 5A1389609519962906Rat
620100Mgat5alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase133867577638959697Rat
1359351Mgat4e-likeMgat4 family, member E-like134583745845843215Rat
1311537Ralgps2Ral GEF with PH domain and SH3 binding motif 2136892467469104637Rat
1308352Ikbkeinhibitor of nuclear factor kappa B kinase subunit epsilon134271215442738470Rat
1311366Epb41l5erythrocyte membrane protein band 4.1 like 5133067305230770213Rat
1310950Camsap2calmodulin regulated spectrin-associated protein family, member 2134772312147802597Rat
1311766Cdc73cell division cycle 73135535722655449690Rat
1310924Dyrk3dual specificity tyrosine phosphorylation regulated kinase 3134259412042604898Rat
1311960Tmcc2transmembrane and coiled-coil domain family 2134379402943831716Rat
1310761Smg7SMG7 nonsense mediated mRNA decay factor136498614565050698Rat
1310816Ube2tubiquitin-conjugating enzyme E2T134640335246413854Rat
1311346Pignphosphatidylinositol glycan anchor biosynthesis, class N132165909221812932Rat
1310441Slc26a9solute carrier family 26 member 9134317780643205450Rat
1312041Shisa4shisa family member 4134680048746803703Rat
1359167Nuak2NUAK family kinase 2134375345443770604Rat
1310970Clasp1cytoplasmic linker associated protein 1132949355429715151Rat
1309424Ncf2neutrophil cytosolic factor 2136495550264986289Rat
1310626Zcchc2zinc finger CCHC-type containing 2132211867722193626Rat
1306522Rgs18regulator of G-protein signaling 18135649423656515862Rat
1305456Tfcp2l1transcription factor CP2-like 1132973381329793870Rat
1307890Trmt1ltRNA methyltransferase 1-like136351009763543268Rat
1304982Tp53i3tumor protein p53 inducible protein 3136961260569655018Rat
1305491Rnf2ring finger protein 2136355396463584047Rat
1309306Mdm4MDM4 regulator of p53134443259644516165Rat
1309205Ccnt2cyclin T2133925157339293172Rat
1308695Swt1SWT1 RNA endoribonuclease homolog136345249463509982Rat
1305969Vps4bvacuolar protein sorting 4 homolog B132290710522932200Rat
1310101Tor3atorsin family 3, member A136876989368798738Rat
1309287Ppp1r12bprotein phosphatase 1, regulatory subunit 12B134619941846397108Rat
1307830Odr4odr-4 GPCR localization factor homolog136236910962424287Rat
1305304Etnk2ethanolamine kinase 2134481122444829037Rat
1306938Thsd7bthrombospondin type 1 domain containing 7B134076856741667262Rat
1306497Serpinb11serpin family B member 11132330477523344604Rat
1306487Rab3gap1RAB3 GTPase activating protein catalytic subunit 1133935569839429154Rat
1309104RGD1309104similar to RIKEN cDNA 1700025G04 gene136398258764199676Rat
1309833Serpinb8serpin family B member 8132362694523650270Rat
1307111Aspmassembly factor for spindle microtubules135107484951123755Rat
1310320Tmem177transmembrane protein 177133102389331027368Rat
1310687Elf3E74 like ETS transcription factor 3134669046046695394Rat
1309602Tmem185btransmembrane protein 185B133064753330650864Rat
1308290Zc3h11azinc finger CCCH-type containing 11A134507342245113901Rat
1310650Kif14kinesin family member 14134792697547990598Rat
1310652Lad1ladinin 1134724960547263967Rat
1311397Slc41a1solute carrier family 41 member 1134327079243291162Rat
1305482Lrrn2leucine rich repeat neuronal 2134432194444382454Rat
1310537Ipo9importin 9134681046046862694Rat
1310664Tprtranslocated promoter region, nuclear basket protein136242431262487502Rat
1308044Lhx4LIM homeobox 4136787361867927003Rat
1306856Cdh7cadherin 7132667205826821571Rat
1307922Tmem9transmembrane protein 9134745848647475832Rat
1307944Ppp1r15bprotein phosphatase 1, regulatory subunit 15B134457784044585737Rat
1308584Tsen15tRNA splicing endonuclease subunit 15136449021664505617Rat
1309947Crb1crumbs cell polarity complex component 1135080148450989261Rat
1309892Tmem183atransmembrane protein 183A134580364145820409Rat
1309674Sox13SRY-box transcription factor 13134483109744875522Rat
1309523Cdk18cyclin-dependent kinase 18134355559743582210Rat
1307472Pkp1plakophilin 1134730960347357551Rat
1306212Tmem163transmembrane protein 163133896791339141664Rat
1308976Prg4proteoglycan 4136248725762504657Rat
1309764Slc45a3solute carrier family 45, member 3134340729343427588Rat
1564063Pm20d1peptidase M20 domain containing 1134323795443259999Rat
1561440RGD1561440similar to nemo like kinase131593453615938158Rat
1562868Serpinb3aserpin family B member 3A132324130323246328Rat
1303151Adipor1adiponectin receptor 1134585946145879248Rat
1562617Rab7bRab7b, member RAS oncogene family134312116843147581Rat
1359726Yod1YOD1 deubiquitinase134217531342177030Rat
1565602Kdm5blysine demethylase 5B134600158946073868Rat
1561765Eif2deukaryotic translation initiation factor 2D134261590142637107Rat
1559752RGD1559752similar to MITF-2B protein132888301128884382Rat
1563709RGD1563709similar to K-ALPHA-1 protein133850748138508832Rat
1565940Arl8aADP-ribosylation factor like GTPase 8A134658584546594851Rat
1564614Cfhr4complement factor H-related 4135142259251491476Rat
708419Brinp2BMP/retinoic acid inducible neural specific 2137043100670532766Rat
1566016Srgap2SLIT-ROBO Rho GTPase activating protein 2134274595642967083Rat
1566099RGD1566099similar to novel protein135041378550418974Rat
1561496Edem3ER degradation enhancing alpha-mannosidase like protein 3136385828263920538Rat
1565760Fam163afamily with sequence similarity 163, member A136826286768341323Rat
1561566LOC498231LRRGT00144134504849845067460Rat
1560256Apobec4apolipoprotein B mRNA editing enzyme catalytic polypeptide like 4136488701964895053Rat
1564952Zranb3zinc finger RANBP2-type containing 3133944065339595782Rat
1359331RabifRAB interacting factor134593637145948929Rat
1308125Slc35f5solute carrier family 35, member F5133699211837028549Rat
1560504Ccdc93coiled-coil domain containing 93133260761832675993Rat
1562794RGD1562794similar to establishment of cohesion 1 homolog 1132744092127444431Rat
1310502Phlda3pleckstrin homology-like domain, family A, member 3134719325047196335Rat
1311668F13bcoagulation factor XIII B chain135113085151156383Rat
1549702NplN-acetylneuraminate pyruvate lyase136565509965697464Rat
1549712Ddx18DEAD-box helicase 18133272969732743161Rat
1549766Serpinb3serpin family B member 3132327412023280082Rat
1359282FcmrFc fragment of IgM receptor134233736342351706Rat
1359520Ddx59DEAD-box helicase 59134787625847901214Rat
1549754Lypd1Ly6/Plaur domain containing 1133732645937368515Rat
1562103Rgs13regulator of G-protein signaling 13135592229055955753Rat
1560523RGD1560523similar to S-adenosylmethionine synthetase gamma form (Methionine adenosyltransferase)132608899726090862Rat
1561854Ascl5achaete-scute family bHLH transcription factor 5134749190047493346Rat
1308112Mgat4eMGAT4 family, member E134598297945991793Rat
1311791Arpc5actin related protein 2/3 complex, subunit 5136490450464913413Rat
1311892Inavainnate immunity activator134766644647687383Rat
1311160Nek7NIMA-related kinase 7135002221250149374Rat
1311162Fam20bFAM20B, glycosaminoglycan xylosylkinase136880166368839979Rat
1560834Zbtb41zinc finger and BTB domain containing 41135104294851065768Rat
1564839RGD1564839similar to ribosomal protein L31134786001747860658Rat
1560339Lgr6leucine-rich repeat-containing G protein-coupled receptor 6134642438246544074Rat
1583578Il20interleukin 20134238098142384625Rat
1566400Map3k19mitogen-activated protein kinase kinase kinase 19133930015039343502Rat
1582969LOC688938similar to heterogeneous nuclear ribonucleoprotein C135163375751635019Rat
1587499LOC689881similar to ribosomal protein L15136495126164952106Rat
1583292Ndufv3-ps1NADH dehydrogenase (ubiquinone) flavoprotein 3, pseudogene 1134591624045916673Rat
1562140RGD1562140similar to brain Zn-finger protein135631975356321734Rat
1583808LOC363996similar to SVH protein134852978948530780Rat
1562134RGD1562134similar to 60S ribosomal protein L9134849660548497272Rat
1586615B3galt2Beta-1,3-galactosyltransferase 2135538940655398419Rat
1563522Lax1lymphocyte transmembrane adaptor 1134513482545145381Rat
1585916LOC679673similar to Ubiquitin-conjugating enzyme E2S (Ubiquitin-conjugating enzyme E2-24 kDa) (Ubiquitin-protein ligase) (Ubiquitin carrier protein) (E2-EPF5)132992363129942719Rat
1584664LOC681080similar to mesoderm development candidate 11352578855440853Rat
1586467Cct3-ps2chaperonin containing Tcp1, subunit 3 (gamma), pseudogene 2134999387349995668Rat
1582913LOC688994similar to 40S ribosomal protein S15 (RIG protein)135304260453047289Rat
1562613RGD1562613similar to U2 small nuclear ribonucleoprotein B134803068648031382Rat
1563614Tnfrsf11aTNF receptor superfamily member 11A132192837021986719Rat
1565034LOC498222similar to specifically androgen-regulated protein134218744242201432Rat
1565977RGD1565977similar to 40S ribosomal protein S3136358934463590898Rat
1566090Mfsd4amajor facilitator superfamily domain containing 4A134346948843510467Rat
1561635RGD1561635similar to 40S ribosomal protein S17136768129567681991Rat
1583546Il19interleukin 19134239771542411637Rat
1565627RGD1565627similar to High mobility group protein 1 (HMG-1)132613486826138359Rat
1584079Cfhr2complement factor H-related 2135117582451247924Rat
1566310Golt1agolgi transport 1A134476035644773123Rat
1565548RGD1565548similar to ribosomal protein L7-like 1135754836957549188Rat
1564395Plekha6pleckstrin homology domain containing A6134461474044754951Rat
1566382Serpinb12serpin family B member 12132305244823083691Rat
1562634LOC498236LRRGT00186134763000447665376Rat
1561738RGD1561738similar to interferon induced transmembrane protein 2 (1-8D)136818713168187808Rat
1584968Cfap221cilia and flagella associated protein 221133104655031118141Rat
1564772Hmcn1hemicentin 1136261546163084524Rat
1566124Axdnd1axonemal dynein light chain domain containing 1136847195768544788Rat
1564507Nckap5NCK-associated protein 5133736994838283257Rat
1565194Cntnap5bcontactin associated protein-like 5B131786336718766983Rat
1565260RGD1565260similar to tumor protein, translationally-controlled 1133212173532122223Rat
1562598RGD1562598similar to 60S ribosomal protein L4 (L1)1368484356849328Rat
1561585RGD1561585similar to PLRR-4 polymorphic leucine-rich repeat protein132863615128637134Rat
1565384Igfn1immunoglobulin-like and fibronectin type III domain containing 1134739561847427506Rat
1583413LOC682479hypothetical protein LOC682479131469931614699912Rat
1584674FcamrFc fragment of IgA and IgM receptor134227389142288002Rat
1583494LOC681197similar to FERM domain containing 31374056537407433Rat
1561544Tmem81transmembrane protein 81134393967743942108Rat
1583817LOC363952similar to Dipeptidyl-peptidase 3 (Dipeptidyl-peptidase III) (DPP III) (Dipeptidyl aminopeptidase III) (Dipeptidyl arylamidase III)132815238128153944Rat
1583818Hnrnpa1-ps1heterogeneous nuclear ribonucleoprotein A1, pseudogene 1132734503327346526Rat
1583819LOC363949similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (38 kDa BFA-dependent ADP-ribosylation substrate) (BARS-38)132382125223822604Rat
1590261Nav1neuron navigator 1134686697247119368Rat
1593499LOC689365similar to Actin-related protein 2/3 complex subunit 1B (ARP2/3 complex 41 kDa subunit) (p41-ARC)135929635159299407Rat
1589662Marcomacrophage receptor with collagenous structure133161627831648521Rat
1585944LOC679645similar to prohibitin131369533213696148Rat
1586357LOC689943similar to 40S ribosomal protein S2136510007265100981Rat
1586370LOC689930similar to peptidylprolyl isomerase D136507127565072221Rat
1592306LOC689456similar to 60S ribosomal protein L29 (P23)136122183861223353Rat
1593124Teddm1transmembrane epididymal protein 1136601749366018750Rat
1592076LOC304754similar to Proteasome activator complex subunit 2 (Proteasome activator 28-beta subunit) (PA28beta) (PA28b) (Activator of multicatalytic protease subunit 2) (11S regulator complex beta subunit) (REG-beta)133818937538190347Rat
1592077LOC304725similar to contactin associated protein-like 5 isoform 1131185376112864307Rat
1587089LOC679594similar to polyubiquitin131180299811803461Rat
1592117LOC289134similar to Alpha-enolase (2-phospho-D-glycerate hydro-lyase) (Non-neural enolase) (NNE) (Enolase 1)136890152168913658Rat
1587045LOC680838hypothetical protein LOC680838133993478239936458Rat
1589074LOC685812similar to ribosomal protein L11134719397347207541Rat
1589741Rgs16regulator of G-protein signaling 16136588778865891232Rat
1587674LOC688505similar to F-box and leucine-rich repeat protein 14134872039348722492Rat
1589909LOC689669hypothetical protein LOC689669136324705363250921Rat
1586783LOC684709similar to putative membrane protein Re9136596894366007077Rat
1590898Abl2ABL proto-oncogene 2, non-receptor tyrosine kinase136867370268839742Rat
1584051Rgsl1regulator of G-protein signaling like 1136591505265969846Rat
1584807LOC679734similar to 40S ribosomal protein S4, Y isoform 2131534048915341938Rat
1588113LOC682054similar to RAN, member RAS oncogene family134338100743383927Rat
1589272LOC683209similar to heterogeneous nuclear ribonucleoprotein F134854206448543445Rat
1593291Mr1major histocompatibility complex, class I-related136729836267317985Rat
1594544LOC301971similar to kinesin family member 13A131601713416021538Rat
1595460Tex35testis expressed 35136922047869232678Rat
1596977LOC678707similar to malignant T cell amplified sequence 1132899512328995667Rat
1598023Fam72afamily with sequence similarity 72, member A134296840942978976Rat
1597466LOC689020similar to heat shock protein 8135346617453468078Rat
1595088En1engrailed homeobox 1133175089231756477Rat
1594177LOC680254hypothetical protein LOC680254136956948569576111Rat
1594585LOC288930similar to Beta-arrestin-1 (Arrestin, beta 1)132651087826512979Rat
1592348LOC689412similar to CG4025-PA136041456560415271Rat
1592636LOC685511similar to 40S ribosomal protein S7 (S8)134595072345951394Rat
1596843LOC680044similar to High mobility group protein 4 (HMG-4) (High mobility group protein 2a) (HMG-2a)132060090720601478Rat
1594583C1ql2complement C1q like 2133147115031472685Rat
1594584LOC288978hypothetical LOC288978133124973331335367Rat
1596806LOC680082similar to cell division cycle associated 4137111330571114442Rat
1591785Pappa2pappalysin 2137087391871147874Rat
1591786LOC680414hypothetical protein LOC680414132336539723369042Rat
1593260Hspd1-ps8heat shock protein 1, pseudogene 8131404430914046528Rat
1598107LOC679963similar to eukaryotic translation elongation factor 1 alpha 1136838982868391692Rat
1598123LOC679947similar to ATP synthase, H+ transporting, mitochondrial F1 complex, gamma subunit136837544268377184Rat
1598128Angptl1angiopoietin-like 1136896319868969742Rat
619769Fmodfibromodulin134549351745504134Rat
1598307LOC364000similar to 40S ribosomal protein S2135223102752233375Rat
1598193LOC501848similar to macrophage expressed gene 1132622188026223810Rat
1598145LOC679925similar to family with sequence similarity 51, member A1 homolog131769333317694256Rat
1625994Vom2r-ps111vomeronasal 2 receptor, pseudogene 111135146812751468471Rat
2319172LOC100361907complement factor H-related protein B135126263151296767Rat
2318727LOC100362156proteasome alpha 6 subunit135517292255173791Rat
2318772LOC100362111ring finger protein 138135417955154189021Rat
2318304LOC100362383DnaJ (Hsp40) homolog, subfamily C, member 10-like133316724733168512Rat
2318305LOC100362382CCDC28A protein-like131593217815932833Rat
2320539LOC100361224ribosomal protein L36a-like134303513043044764Rat
2322251LOC100363803hypothetical LOC100363803134333991343340439Rat
2322265LOC100360388hypothetical LOC1003603881367594806765982Rat
2320695Rgs21regulator of G-protein signaling 21135624253356266573Rat
2321508LOC100360750Sm protein F-like134211401342116559Rat
2322306LOC100360347hypothetical LOC1003603471359342355935893Rat
2321674LOC100360683protein S100-A11-like136575661265759510Rat
2321675Snrpesmall nuclear ribonucleoprotein polypeptide E134505098645057231Rat
2321708LOC100360649mitochondrial ribosomal protein L30134172398441724457Rat
2322511LOC100360239hypothetical LOC100360239134419981544200394Rat
2322549LOC100360201cyclin B1 interacting protein 1-like136631153466312300Rat
2322665LOC100360184splicing factor proline/glutamine rich (polypyrimidine tract binding protein associated)1351607585190666Rat
2321136LOC100360923SET and MYND domain containing 3-like131504460815045633Rat
2321906LOC100360551GABA(A) receptor-associated protein-like 2-like134066230740662660Rat
2321949LOC100360508ribosomal protein S26-like133986368839864147Rat
2323366LOC100363274UPF3 regulator of nonsense transcripts homolog B-like132757265027597288Rat
2323778Zfp648zinc finger protein 648136633709866344963Rat
2324512LOC100362542MAD homolog 2136138061361382079Rat
2325425Mir181a-1microRNA 181a-1134948552749485626Rat
2325487Mir488microRNA 488137068306470683142Rat
2325561Mir181b1microRNA 181b-1134948568849485797Rat
2325574Mir128-1microRNA 128-1133969944939699530Rat
2325610Mir135bmicroRNA 135b134363885743638953Rat
4888558Mir3570microRNA 3570134948550849485624Rat
2324722LOC100363168transmembrane protein 64-like132721750627283978Rat
2324561LOC100362110LRRGT00155-like133690776036941966Rat
2325079Selenok-ps2selenoprotein K, pseudogene 21396814399683245Rat
5128565LOC100526819deoxyuridine triphosphatase pseudogene136776429967765086Rat
6489269LOC100912003uncharacterized LOC100912003133378320833786022Rat
6488950LOC100912060serine/arginine-rich splicing factor 6-like136930786069311387Rat
6494480LOC100911239uncharacterized LOC100911239131101098011026384Rat
6485077LOC100912998zinc finger protein 420-like131085932910884072Rat
6491293LOC100911717uncharacterized LOC100911717136216000262163710Rat
6487798LOC100912334ubiquitin-like protein FUBI-like132162910221629445Rat
6490239LOC100911899transcription factor BTF3-like131723827017239523Rat
6490323LOC100911912heterogeneous nuclear ribonucleoprotein A3-like133277070432771717Rat
6502812Avpr1barginine vasopressin receptor 1B134304696043057110Rat
6496985LOC100910715eukaryotic elongation factor 2 kinase-like132887600128880880Rat
6500808LOC10091000860S ribosomal protein L15-like136508136565082179Rat
7501983LOC102550525uncharacterized LOC102550525134480077244802578Rat
7514622LOC102557118uncharacterized LOC102557118134538044245384435Rat
7489024Mir3473microRNA 3473133949924639499312Rat
7540956LOC102547307uncharacterized LOC102547307134789793147909758Rat
7528970LOC102553722uncharacterized LOC102553722134711749947121805Rat
7529420LOC102553684eukaryotic initiation factor 4A-I-like131251196712513501Rat
7498875LOC102547165uncharacterized LOC102547165132105507721068613Rat
7531223LOC102548579uncharacterized LOC102548579134974291349753887Rat
7516494LOC102548181uncharacterized LOC102548181134856681248598951Rat
7517596LOC102547127heat shock protein HSP 90-alpha-like132949450229497346Rat
7517597LOC102551071myosin light polypeptide 6-like1399032869903991Rat
7645761LOC102555306complement factor H-like135132597851336204Rat
7633688LOC102552406uncharacterized LOC102552406134561360645636556Rat
7636347LOC10254930260S ribosomal protein L9-like135534264055347449Rat
7576045LOC102553197uncharacterized LOC102553197132332281923336975Rat
7577736LOC102554198uncharacterized LOC102554198133684413936862825Rat
7640179LOC102548908uncharacterized LOC102548908134033504140350489Rat
7656010LOC102552819uncharacterized LOC102552819136725586867260117Rat
7657602LOC102551528uncharacterized LOC102551528136467371864682656Rat
7641700LOC102550524uncharacterized LOC102550524132206441822111976Rat
7629682LOC102555701elongation factor 2-like132800777028011026Rat
7660382LOC10255266740S ribosomal protein S27-like136719741767197656Rat
7661875LOC102556005uncharacterized LOC102556005134334275643344946Rat
7592623LOC102547698uncharacterized LOC102547698134815558348192151Rat
7544266LOC102553685uncharacterized LOC102553685136762168967650996Rat
7601016LOC102549704heat shock protein HSP 90-alpha-like1365573266558091Rat
7561471LOC102551374uncharacterized LOC102551374135574418455779661Rat
7581466LOC102552334uncharacterized LOC102552334135945364459485365Rat
7603068LOC102555474uncharacterized LOC1025554741365480346553218Rat
7603387Clec20aC-type lectin domain containing 20A136923276969258134Rat
7606491LOC102547468uncharacterized LOC102547468136769957567702579Rat
7690852LOC102547822uncharacterized LOC102547822134827521548279720Rat
7677982LOC1025487125' exonuclease Apollo-like136871882868720740Rat
7686641LOC102551886uncharacterized LOC102551886136554722565550196Rat
7688772LOC10254702160S ribosomal protein L7-like132948435529485077Rat
7713048LOC102554127uncharacterized LOC102554127133646666736468943Rat
7739330LOC102552277uncharacterized LOC102552277135942587659443220Rat
7739800LOC102551797ornithine decarboxylase-like136545749165469973Rat
7667252LOC102548838uncharacterized LOC102548838134016792440173369Rat
7716636LOC102552627zinc finger protein 160-like131077318910776173Rat
7743630LOC102547022uncharacterized LOC102547022135507932155258202Rat
7701520LOC102550337uncharacterized LOC102550337132202801022042859Rat
7674871LOC102547588uncharacterized LOC102547588134812037948137712Rat
7728603LOC102554977complement factor H-related protein 1-like135136121351385048Rat
7681392LOC102553130zinc finger protein 665-like131145209311468047Rat
9091700LOC103691604uncharacterized LOC103691604131531458815381026Rat
9078385Lnc134long non-coding RNA 134134589496445899883Rat
9160875LOC103691608uncharacterized LOC103691608132126231621264777Rat
9117769LOC103691598methionine adenosyltransferase 2 subunit beta pseudogene131483603514836975Rat
9209511LOC103691611cyclin-dependent kinases regulatory subunit 1 pseudogene132656388326564406Rat
9272792LOC103693671uncharacterized protein C1orf43 homolog pseudogene134826830348268931Rat
9238526Zbed6zinc finger, BED-type containing 6134510748945113141Rat
9333559LOC10369192228S ribosomal protein L42, mitochondrial134764404047645622Rat
9380288LOC103690256developmental pluripotency-associated protein 2 pseudogene133290068832901604Rat
9461626LOC103692077uncharacterized LOC103692077134492825644937589Rat
9467553LOC103691878uncharacterized LOC103691878134317629543196541Rat
9476423LOC103690298NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 3 pseudogene133290235732902654Rat
9400371LOC103691625protein phosphatase 1 regulatory subunit 14B pseudogene131952200919522605Rat
9417070LOC103692078ubiquitin-conjugating enzyme E2 D4-like134878442248784894Rat
9219038LOC103691931uncharacterized LOC103691931135566677155685220Rat
9418531LOC103693673phosphoenolpyruvate carboxykinase [GTP], mitochondrial pseudogene136060900260610979Rat
9685080Mir1843bmicroRNA 1843b137155154871551609Rat
11369964LOC108352529NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 3 pseudogene134288365042891923Rat
11371098LOC108352642glyceraldehyde-3-phosphate dehydrogenase-like134046535740466360Rat
11462184LOC108352511uncharacterized LOC1083525111391719559365032Rat
11443633LOC108352542uncharacterized LOC108352542135030453050334723Rat
11466399LOC108352547uncharacterized LOC108352547135674709756874199Rat
11468747LOC108352538uncharacterized LOC108352538134840724648412548Rat
11469342LOC108352516uncharacterized LOC108352516132201820222027872Rat
11474113LOC108353403endogenous retrovirus group K member 19 Env polyprotein-like132561754425619382Rat
11474461LOC108352644uncharacterized LOC108352644135664764456651569Rat
11457516LOC108352541uncharacterized LOC108352541134941760449546358Rat
11457739LOC108352514uncharacterized LOC108352514131690756616931271Rat
11369155LOC108352640uncharacterized LOC108352640133338380333405325Rat
11432035LOC108352624uncharacterized LOC108352624133594992936144808Rat
11442089LOC108352557uncharacterized LOC108352557136727525867284186Rat
11453213LOC108352533uncharacterized LOC108352533134511636845130742Rat
11453963LOC10835252760S ribosomal protein L37 pseudogene133974995339750218Rat
11383645LOC108352617prothymosin alpha pseudogene135822663058226954Rat
11394992LOC108352518uncharacterized LOC108352518132258998722598210Rat
11414926LOC10835261540S ribosomal protein S28 pseudogene132697477926974991Rat
11417017LOC108352524cysteine and glycine-rich protein 2 pseudogene133858125138587400Rat
11417578LOC108352647guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-5 pseudogene136618778566188335Rat
11419406LOC10835255160S ribosomal protein L23a pseudogene136389499663895471Rat
11376556LOC108352643SRA stem-loop-interacting RNA-binding protein, mitochondrial pseudogene135391927553919609Rat
11377184LOC108352532uncharacterized LOC108352532134422058144222116Rat
11387688LOC108352645non-histone chromosomal protein HMG-14 pseudogene135722779857228089Rat
11389558LOC108352618endogenous retrovirus group K member 113 Gag polyprotein-like136113043561134600Rat
11379461LOC108352553uncharacterized LOC108352553136432864964402638Rat
11392346LOC108352545uncharacterized LOC108352545135544205155468836Rat
11382668LOC108352528glyceraldehyde-3-phosphate dehydrogenase pseudogene134196320941966846Rat
11501111LOC108352638dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit 4-like132835770028357816Rat
11518999LOC108352543POU domain, class 5, transcription factor 1 pseudogene135142543951426788Rat
11501382LOC108352641glyceraldehyde-3-phosphate dehydrogenase pseudogene133433454434335544Rat
11477275LOC108353429endogenous retrovirus group K member 10 Gag polyprotein-like132562263025625688Rat
11506008LOC108352536uncharacterized LOC108352536134706715547070010Rat
11508071LOC108352552uncharacterized LOC108352552136415925864169444Rat
11509631LOC108352526uncharacterized LOC108352526133924535439251593Rat
11511033LOC108352605ubiquitin-conjugating enzyme E2 G1 pseudogene136660363666607613Rat
11491242LOC108352544uncharacterized LOC108352544135514345155150865Rat
41353387LOC120096270uncharacterized LOC120096270135580120755801977Rat
41086608LOC120096281heterogeneous nuclear ribonucleoprotein A3-like136594073265942250Rat
41356646LOC120096232uncharacterized LOC120096232133086018930869062Rat
41380764NEWGENE_40926764transfer RNA proline (anticodon AGG)133976402339764103Rat
41139344LOC120096225uncharacterized LOC120096225131105582811057316Rat
41168767LOC120096465U6 spliceosomal RNA134870751048707619Rat
41250377LOC120096282uncharacterized LOC120096282136612708666138232Rat
41277644LOC120096262uncharacterized LOC120096262135048752350511638Rat
41383899LOC120096200uncharacterized LOC120096200133378636533790963Rat
41089389LOC120096178uncharacterized LOC120096178136095664060957991Rat
41089780LOC120096203uncharacterized LOC120096203134987376849877506Rat
41141102LOC120096265macrophage migration inhibitory factor-like135192859551937627Rat
41170686LOC120096239uncharacterized LOC120096239133893059138934947Rat
41170996LOC120096204glyceraldehyde-3-phosphate dehydrogenase-like136710388367105076Rat
41205587LOC120096261prothymosin alpha-like135023323450236319Rat
41278710NEWGENE_41155962transfer RNA lysine (anticodon UUU)134448230744482379Rat
41325179NEWGENE_40933693transfer RNA proline (anticodon GGG)131316820113168282Rat
41359476LOC120096190uncharacterized LOC120096190134584375445854407Rat
41384774LOC120096447U6 spliceosomal RNA135844882558448931Rat
41090247LOC120096222uncharacterized LOC1200962221374468547469250Rat
41115546LOC120096260uncharacterized LOC120096260135015892750199965Rat
41286775LOC120096294E3 ubiquitin-protein ligase COP1-like137142821071466040Rat
41386640LOC120096219male-enhanced antigen 1-like133961975939630738Rat
41387536LOC120096221poly(A) RNA polymerase GLD2-like134971675149719879Rat
41145416LOC120096275putative monooxygenase p33MONOX136222634162229836Rat
41145509LOC120096188uncharacterized LOC120096188134441333944418366Rat
41145667LOC12009619840S ribosomal protein S10-like132991337829914001Rat
41173336LOC120096403U2 spliceosomal RNA135869077658690958Rat
41208516LOC120096271uncharacterized LOC120096271135778059357877565Rat
41208883LOC120096454U6 spliceosomal RNA133065190530652011Rat
41259378LOC120096243uncharacterized LOC120096243134016797240168697Rat
41327582LOC120096255uncharacterized LOC120096255134696612146973821Rat
41187100LOC120096293uncharacterized LOC120096293136980137769886020Rat
41328721LOC120096234uncharacterized LOC120096234133282316132876593Rat
41362762LOC120096463U6 spliceosomal RNA135274260752742717Rat
41362831LOC120096438U4 spliceosomal RNA135112060051120725Rat
41363484LOC120096289uncharacterized LOC120096289136829342868299278Rat
41390187LOC120096213solute carrier family 25 member 36-like1350820165160317Rat
41177193LOC120096257uncharacterized LOC120096257134766902947676924Rat
41188211LOC120096283eukaryotic translation initiation factor 3 subunit M-like136622126266223067Rat
41330862LOC120096453U6 spliceosomal RNA135357244653572552Rat
41178418LOC120096273uncharacterized LOC120096273135882140758874510Rat
41178723LOC120096460U6 spliceosomal RNA135985108759851186Rat
41212925LOC120096445U6 spliceosomal RNA134130467841304784Rat
41265064LOC120096369U6 spliceosomal RNA136726326267263367Rat
41342357LOC120096267uncharacterized LOC120096267135525830055264641Rat
41343085LOC120096240RNA-binding protein FUS-like133936160039366255Rat
41122660LOC120096197uncharacterized LOC120096197132984957129856937Rat
41154132LOC120096396small nucleolar RNA SNORA17133466251334662643Rat
41192305LOC120096287uncharacterized LOC120096287136803731568056961Rat
41288161LOC120096236uncharacterized LOC120096236133641760236440116Rat
41125122LOC120096456U6 spliceosomal RNA1395358489535957Rat
41181148LOC120096216glyceraldehyde-3-phosphate dehydrogenase-like132199505421996060Rat
41193295LOC120096448U6 spliceosomal RNA136140368061403786Rat
41216273LOC120096427small nucleolar RNA U109135552235955522493Rat
41267176LOC120096387small nucleolar RNA SNORA36 family133936360339363733Rat
41345153LOC120096248ethanolamine kinase 2-like134481453744829052Rat
41125722LOC120096214igE-binding protein-like1376183377624095Rat
41158336LOC120096246uncharacterized LOC120096246134275133642767711Rat
41182474LOC120096227uncharacterized LOC120096227131690459316910352Rat
41182485LOC120096405small nucleolar RNA SNORA17136032876360328895Rat
41182620LOC120096280uncharacterized LOC120096280136564394665654938Rat
41289916LOC120096412small nucleolar RNA SNORA17131224084912240975Rat
41289942LOC120096428U2 spliceosomal RNA1374520587452137Rat
41070118LOC120096220uncharacterized LOC120096220134768658347690468Rat
41128108LOC120096435U2 spliceosomal RNA135582745755827636Rat
41159165LOC120096256uncharacterized LOC120096256134705190547054848Rat
41219353LOC12009624540S ribosomal protein S10-like134239552042397528Rat
41220033LOC120096274uncharacterized LOC120096274135912258059156856Rat
41373884LOC120096378small nucleolar RNA SNORA70133998495139985085Rat
41400277LOC120096264glyceraldehyde-3-phosphate dehydrogenase-like135079289350794127Rat
41071536LOC120096373U7 small nuclear RNA133386668833866751Rat
41072330LOC120096215igE-binding protein-like131653241816538949Rat
41104579LOC120096251uncharacterized LOC120096251134550307245523082Rat
41128384LOC120096417small nucleolar RNA SNORA17132341396723414096Rat
41185192LOC120096443U6 spliceosomal RNA1396563169656422Rat
41197309LOC120096244uncharacterized LOC120096244134119071441202717Rat
41197903LOC120096414U2 spliceosomal RNA135235842952358585Rat
41228947LOC120096433U2 spliceosomal RNA132796494127965064Rat
41229690LOC120096288uncharacterized LOC120096288136821121168222867Rat
41293470LOC120096226cellular tumor antigen p53-like131206496212071434Rat
41401176NEWGENE_41155962transfer RNA lysine (anticodon UUU)134448191644481988Rat
41130351LOC120096253uncharacterized LOC120096253134676300046776339Rat
41131179LOC120096229uncharacterized LOC120096229132273222722739137Rat
41162937LOC120096279uncharacterized LOC120096279136513564165145949Rat
41199188NEWGENE_41004142transfer RNA glycine (anticodon UCC)134240316742403238Rat
41294798LOC120096258uncharacterized LOC120096258134813331848143298Rat
41351842LOC120096185uncharacterized LOC120096185134375416743760164Rat
41401987LOC120096367U6 spliceosomal RNA136054177860541876Rat
41082629NEWGENE_40934091transfer RNA alanine (anticodon AGC)132760763127607705Rat
41082826LOC120096199uncharacterized LOC120096199133098178530983255Rat
41083747LOC120096235SLC35A4 upstream open reading frame protein-like132863752528637836Rat
41108584LOC120096429U2 spliceosomal RNA133966495739665099Rat
41232549LOC120096420small nucleolar RNA SNORA17136144256361442671Rat
41275147LOC120096223MAPK-interacting and spindle-stabilizing protein-like131000361610007430Rat
41377638LOC120096425small nucleolar RNA U13136290295462903058Rat
41165305LOC120096372U7 small nuclear RNA134846321548463275Rat
41165395LOC120096398small nucleolar RNA SNORA17131842296618423097Rat
40945853LOC120096400small nucleolar RNA SNORA17136015142760151558Rat
40997506LOC120096278uncharacterized LOC120096278136428266564287061Rat
40946709LOC120096393small nucleolar RNA SNORA48136978564869785786Rat
41010849LOC120096395small nucleolar RNA SNORA17132396296623963097Rat
40951988LOC120096247uncharacterized LOC120096247134292046642952071Rat
40953093LOC120096434U2 spliceosomal RNA132988468829884743Rat
40953707LOC12009629260S ribosomal protein L28-like136985473269857761Rat
40929865LOC120096464U6 spliceosomal RNA136174148761741592Rat
40930414LOC120096263uncharacterized LOC120096263135075797650759061Rat
40957481NEWGENE_40926764transfer RNA proline (anticodon AGG)134805899348059078Rat
40984291LOC120096268uncharacterized LOC120096268135552345055526544Rat
40934896LOC120096202uncharacterized LOC120096202134885424748861728Rat
41007714LOC120096284uncharacterized LOC120096284136622022266222911Rat
40937936LOC120096418small nucleolar RNA SNORA17134886166148861776Rat
40989265LOC120096252uncharacterized LOC120096252134658088246582653Rat
41010017LOC120096217protein PRRC2B-like132325107023256472Rat
41010028NEWGENE_40938314transfer RNA serine (anticodon AGA)133983277939832859Rat
40965712LOC120096439U4 spliceosomal RNA134086368040863870Rat
40941817LOC120096201ferritin light chain 1-like133849046838492427Rat
40967358LOC120096187uncharacterized LOC120096187134440754344411825Rat
40993431LOC120096406small nucleolar RNA SNORA17134425476144254882Rat
40993432LOC120096450U6 spliceosomal RNA136335918863359294Rat
40969561LOC120096259uncharacterized LOC120096259135007389450085983Rat
40995925LOC120096444U6 spliceosomal RNA131586392815864034Rat
41047751LOC120096237uncharacterized LOC120096237133686292036867620Rat
41024668LOC120096388small nucleolar RNA U6-53/MBII-28133885055138850659Rat
41049185LOC120096242uncharacterized LOC120096242134003193040047733Rat
41075572LOC120096249NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 10-like134512119745122944Rat
41244932LOC120096442U6 spliceosomal RNA132696330326963409Rat
41312878LOC120096230uncharacterized LOC120096230132940416629407806Rat
41026629LOC120096228dnaJ homolog subfamily C member 14-like131727147617273698Rat
41077524LOC120096186uncharacterized LOC120096186134420495044209708Rat
41245870LOC120096254uncharacterized LOC120096254134708947547097382Rat
41316423LOC120096366U6 spliceosomal RNA136424129164241348Rat
41316489NEWGENE_40973998transfer RNA histidin (anticodon AUG)132190993821910012Rat
41247988LOC120096397small nucleolar RNA SNORA17132956172329561851Rat
41052762LOC120093156ras GTPase-activating protein nGAP-like136925862269272353Rat
41052885LOC120096191ubiquitin-conjugating enzyme E2 C-like134623456746243280Rat
41333015LOC120096411small nucleolar RNA SNORA17132623216626232296Rat
41054534LOC120096424U2 spliceosomal RNA133485878534858948Rat
41143873LOC120096449U6 spliceosomal RNA136868913868689244Rat
41255751LOC120096231ankyrin repeat domain-containing protein 49-like133094031230946968Rat
41152662LOC120096381small nucleolar RNA SNORD50132615472426154795Rat
41257974LOC120096238uncharacterized LOC120096238133857113338578302Rat
41335505LOC120096224uncharacterized LOC120096224131102950611037640Rat
41220427LOC120096436small nucleolar RNA U3136064539960645487Rat
41297106LOC120096179transmembrane protein 208-like136215434362155350Rat
41032285LOC120096272uncharacterized LOC120096272135790644658016448Rat
41032515LOC120096399small nucleolar RNA SNORA17136621940066219531Rat
41058689LOC120096437U4 spliceosomal RNA136316528463165394Rat
41299659LOC120096218glyceraldehyde-3-phosphate dehydrogenase-like132867250228677930Rat
41059766LOC120096423U4atac minor spliceosomal RNA132956736129567485Rat
41337984LOC120096250uncharacterized LOC120096250134513631545140254Rat
41035098LOC120096269uncharacterized LOC120096269135570522355796688Rat
41062024LOC120096277uncharacterized LOC120096277136395152963957170Rat
41062375LOC120096276uncharacterized LOC120096276136249626662568134Rat
41226902LOC120096452U6 spliceosomal RNA134396455243964658Rat
41334534LOC12009618460S ribosomal protein L23a-like133557156735572037Rat
41334650LOC120096291uncharacterized LOC120096291136975292869762525Rat
41064276LOC120096266uncharacterized LOC120096266135229115852305340Rat
41303516LOC120096233uncharacterized LOC120096233133225144632288690Rat
41016284LOC120096189uncharacterized LOC120096189134575604045759682Rat
41017587LOC120096459U6 spliceosomal RNA134038967540389783Rat
41066519LOC120096371U1 spliceosomal RNA135211677652116948Rat
41237523LOC120096290ATP synthase F(0) complex subunit C2, mitochondrial-like136967435669674860Rat
41042311LOC12009628660S ribosomal protein L37-like136789489667896073Rat
41310072LOC120096285uncharacterized LOC120096285136759638167611639Rat
41023674LOC120096241COX assembly mitochondrial protein homolog133951341939513580Rat
2536Ednrbendothelin receptor type B158064083980672115Rat
61800Htr2a5-hydroxytryptamine receptor 2A154995003550022188Rat
69350Pcdh8protocadherin 8155519847555203021Rat
2079Akap11A-kinase anchoring protein 11155391163553956138Rat
619721Rgccregulator of cell cycle155466248354675320Rat
3850Tsc22d1TSC22 domain family, member 1155175048951850958Rat
727855SetsipSET-like protein157451290974513767Rat
620176Cnmdchondromodulin155504154855066297Rat
620772Gtf2f2general transcription factor IIF subunit 2155120602751327166Rat
621446Klf5Kruppel-like factor 5157606032076079445Rat
620697Elf1E74 like ETS transcription factor 1155489064454986721Rat
620784Tnfsf11TNF superfamily member 11155367499053705171Rat
1304929Rubcnlrubicon like autophagy enhancer155033245850377494Rat
71035Cpb2carboxypeptidase B2155055772250606569Rat
620033Wbp4WW domain binding protein 4155486270054890668Rat
620074Pou4f1POU class 4 homeobox 1158125556681260057Rat
621623Tpt1tumor protein, translationally-controlled 1155115672851159629Rat
1304646Dis3DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease157582004075850450Rat
1305086Kbtbd6kelch repeat and BTB domain containing 6155484828554850042Rat
1305102Scelsciellin158033966180456546Rat
1306118Enox1ecto-NOX disulfide-thiol exchanger 1155251783353079752Rat
1307452Klhl1kelch-like family member 1157269818873142707Rat
1308858Slitrk1SLIT and NTRK-like family, member 1158572325285727290Rat
1306550Slitrk6SLIT and NTRK-like family, member 6158756350687570125Rat
1305077Pibf1progesterone immunomodulatory binding factor 1157585038976019711Rat
1306348Pcdh9protocadherin 9156934010870237531Rat
1306441RGD1306441similar to RIKEN cDNA 4921530L21157246415772468708Rat
1304753Pcdh17protocadherin 17156022208860316172Rat
1307254Gpalpp1GPALPP motifs containing 1155141188351429435Rat
1304555Cog3component of oligomeric golgi complex 3155102080851071288Rat
1307729Zc3h13zinc finger CCCH type containing 13155060733550671802Rat
1308772Vwa8von Willebrand factor A domain containing 8155425270354576871Rat
1306297Pcdh20protocadherin 20156442553464431790Rat
1308626Slain1SLAIN motif family, member 1158048281880542461Rat
1311708Olfm4olfactomedin 4155538510055429687Rat
1311472Spry2sprouty RTK signaling antagonist 2158269231282697408Rat
1312048Mycbp2MYC binding protein 2157993735480175432Rat
1559507Lrrc63leucine rich repeat containing 63155040019950437321Rat
1310185Lacc1laccase domain containing 1155239026752407630Rat
1309421Kctd12potassium channel tetramerization domain containing 12157980007779806064Rat
1305660Fbxl3F-box and leucine-rich repeat protein 3157990679579926678Rat
1310303Esco2-ps2establishment of cohesion 1 homolog 2 (S. cerevisiae), pseudogene 2155045229150455762Rat
1307550Sugt1SGT1 homolog, MIS12 kinetochore complex assembly cochaperone155499141955032244Rat
1308297Rbm26RNA binding motif protein 26158188478381964245Rat
1310957Slitrk5SLIT and NTRK-like family, member 5158884812388858809Rat
1309204Klf12Kruppel-like factor 12157662877877062000Rat
1306965Cln5CLN5, intracellular trafficking protein157989357379903438Rat
1307154Dnajc15DnaJ heat shock protein family (Hsp40) member C15155318206053249675Rat
1308288Lcp1lymphocyte cytosolic protein 1155044330050544682Rat
1310126Tdrd3tudor domain containing 3156334053163497208Rat
1309522Borabora, aurora kinase A activator157579762475835599Rat
1564706Obi1ORC ubiquitin ligase 1158126941381308734Rat
1559579RGD1559579similar to Ski protein157416494974169032Rat
1561955Dgkhdiacylglycerol kinase, eta155398107954150470Rat
1561196Uchl3ubiquitin C-terminal hydrolase L3157848530478527355Rat
1359702Slc25a30solute carrier family 25, member 30155107699851099613Rat
1561044Cby2chibby family member 2155090943551004449Rat
1559682Ppial4gpeptidylprolyl isomerase A like 4G157401562874016215Rat
1560137Fam216bfamily with sequence similarity 216, member B155348924353496717Rat
1563207Epsti1epithelial stromal interaction 1155328396453382192Rat
1309716Ndfip2Nedd4 family interacting protein 2158203236682087043Rat
1302984Lmo7LIM domain 7157856702978769833Rat
1560745Commd6COMM domain containing 6157846733378474382Rat
1559833RGD1559833similar to 60S ribosomal protein L5158869968988700973Rat
1560069RGD1560069similar to ribosomal protein L27157501018575011443Rat
1566076Serp2stress-associated endoplasmic reticulum protein family member 2155187988451903965Rat
1561609Tbc1d4TBC1 domain family, member 4157825603078434168Rat
1584329Mtrf1mitochondrial translation release factor 1155477688554804699Rat
1584320LOC686244similar to ribosomal protein S24155481614854816642Rat
1584324Naa16N(alpha)-acetyltransferase 16, NatA auxiliary subunit155471162054770915Rat
1565615Trim52tripartite motif-containing 52158288623782924611Rat
1359440Nufip1nuclear FMR1 interacting protein 1155142951851460308Rat
1563454Acod1aconitate decarboxylase 1157987181979881101Rat
1564564LOC306079similar to RIKEN cDNA 3100001N19155552033255531842Rat
1592157LOC692015similar to cytochrome P450, family 2, subfamily c, polypeptide 66155684739456863597Rat
1593227LOC364462similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)158316576883173084Rat
1592131LOC692041hypothetical protein LOC692041158232682782327275Rat
1592138LOC692034similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)157880882278810075Rat
1592139LOC692033similar to ribosomal protein L10a157731037477317398Rat
1592140Mzt1mitotic spindle organizing protein 1157578699275797631Rat
1592142LOC692030similar to pescadillo homolog 1, containing BRCT domain157532363475325610Rat
1592145LOC692027similar to family with sequence similarity 60, member A157231631972318425Rat
1592146LOC692026similar to mesenchymal stem cell protein DSC92157145020371453611Rat
1592168Siah3siah E3 ubiquitin protein ligase family member 3155077096350834278Rat
1592073Dach1dachshund family transcription factor 1157452812274909811Rat
1592167LOC692005hypothetical protein LOC692005155098554950986428Rat
1592151LOC692021similar to 3-phosphoglycerate dehydrogenase156580583465807366Rat
1592156LOC692016similar to sorbitol dehydrogenase 1155712815857129211Rat
1595676LOC502027similar to Voltage-dependent anion-selective channel protein 1 (VDAC-1) (mVDAC1) (mVDAC5) (Outer mitochondrial membrane protein porin 1) (Plasmalemmal porin)157047334670479101Rat
1595677LOC502026similar to non-POU domain containing, octamer-binding156738764167435806Rat
1595678Lrch1leucine rich repeats and calponin homology domain containing 1155007060550249724Rat
1592109LOC290453hypothetical LOC290453158173608781737952Rat
1593287Diaph3diaphanous-related formin 3156254337563013060Rat
1593229LOC364451similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)157509038375091676Rat
1592110LOC290444similar to eukaryotic translation initiation factor 3, subunit 12157897398078974607Rat
1592111LOC290428similar to small nuclear ribonucleoparticle-associated protein157319364773194285Rat
1592113LOC290412similar to Pyruvate kinase isozymes M1/M2 (Pyruvate kinase muscle isozyme)156431995864321551Rat
1592114Esdesterase D155004363450063134Rat
1594637Kctd4potassium channel tetramerization domain containing 4155126366451278030Rat
1590791LOC498555similar to 60S acidic ribosomal protein P2156763836567638804Rat
1597679Calm-ps2calmodulin pseudogene 2155811060058111718Rat
2319369LOC100361805WD repeat domain 12158769675987698451Rat
2319992LOC100364974hypothetical LOC100364974158220537682205981Rat
2320118LOC100361447hypothetical LOC100361447156542691565427910Rat
2320163LOC100361402hypothetical LOC100361402156327575063276346Rat
2319521LOC100361753apolipoprotein O-like158661594886617012Rat
2319690LOC100361683cyclin-dependent kinase 4156737104667371603Rat
2323417LOC100363223hypothetical LOC100363223158249735882498715Rat
2320681LOC10036118040S ribosomal protein S17-like155717842557179006Rat
2321506Ccdc122coiled-coil domain containing 122155240780652470050Rat
2320734RGD2320734cytochrome b-c1 complex subunit 9-like157844839778452589Rat
2321527LOC100360731SNRPN upstream reading frame protein-like157319322273193407Rat
2323017LOC100363428PCNA-associated factor-like158461031484612236Rat
2321672LOC100360685breast cancer associated 3157257613772579688Rat
2320932LOC100361028Spi-C transcription factor (Spi-1/PU.1 related)-like157582978175831885Rat
2321007LOC100364453hypothetical LOC100364453157620740576208337Rat
2323174LOC100363369hypothetical LOC100363369158440878284410255Rat
2324281Selenok-ps4selenoprotein K, pseudogene 4157760905977609793Rat
2323641LOC100359553heterogeneous nuclear ribonucleoprotein A1-like158737599687415696Rat
2323955LOC100362823hypothetical LOC100362823157853373578534635Rat
2325470Mir759microRNA 759155514202255142118Rat
2324592LOC100360244LRRGT00053-like155499082554991667Rat
6491099Erich6bglutamate-rich 6B155097906651014394Rat
6501695Kbtbd7kelch repeat and BTB domain containing 7155480687854811457Rat
6498975LOC10091037940S ribosomal protein S13-like158228226982285536Rat
6496491LOC10091076640S ribosomal protein SA-like156394891363949900Rat
6500878LOC100909907uncharacterized LOC100909907158029136880301194Rat
6501416LOC10090989560S ribosomal protein L15-like155482252954823866Rat
6501536LOC100909790glutamine synthetase-like155470241154704851Rat
7502353LOC102546379uncharacterized LOC102546379157967613879677687Rat
7536491LOC102554612MLV-related proviral Env polyprotein-like158533635685338410Rat
7631267LOC102556319uncharacterized LOC102556319155191597951929359Rat
7632669LOC102546300uncharacterized LOC102546300157962671979635335Rat
7651565LOC102546653uncharacterized LOC102546653156686439666876742Rat
7653320LOC102553927uncharacterized LOC102553927157627260276347580Rat
7577763LOC102556284uncharacterized LOC102556284157938945979463606Rat
7625858LOC102550655uncharacterized LOC102550655158168480081693102Rat
7661800LOC102549816uncharacterized LOC102549816155386129753864972Rat
7615992LOC102550034uncharacterized LOC102550034158025787180259789Rat
7590644LOC102554519glyceraldehyde-3-phosphate dehydrogenase-like158509422085095216Rat
7599070LOC102546539uncharacterized LOC102546539154983625449851944Rat
7552264LOC102547864uncharacterized LOC102547864156655133366593853Rat
7607858LOC102547865AFG3-like protein 1-like157251057272511658Rat
7554821LOC102546958MLV-related proviral Env polyprotein-like156673717466757250Rat
7554898LOC102551509uncharacterized LOC102551509158237271682380113Rat
41054335LOC12009706840S ribosomal protein S11-like158196856981971604Rat
7751243LOC102550182uncharacterized LOC102550182158067233480695485Rat
7695025LOC102549099uncharacterized LOC102549099155117522651192638Rat
7666955LOC102550758uncharacterized LOC102550758158169622481700611Rat
7742907LOC102550315uncharacterized LOC102550315158097601180978272Rat
7699265LOC102552389uncharacterized LOC102552389155114431451149510Rat
7700048LOC102546462uncharacterized LOC102546462155217781152273499Rat
7672387LOC102554138uncharacterized LOC102554138155806456458084413Rat
7747880LOC102556470uncharacterized LOC102556470158857410588758613Rat
7679581LOC102555382uncharacterized LOC102555382157783604977841407Rat
9094045LOC103693719uncharacterized LOC103693719155201892052027569Rat
9173655LOC103693718high mobility group protein HMG-I/HMG-Y-like155146046051463125Rat
9142262LOC103693717uncharacterized LOC103693717155139785351408059Rat
9082307LOC103690313uncharacterized LOC103690313155135980051362026Rat
9187193LOC103693842ferritin light chain 1 pseudogene158483465984835093Rat
9194298LOC103693766uncharacterized LOC103693766157664178776658502Rat
9205700LOC103693880uncharacterized LOC103693880156019854560221983Rat
9333309LOC103693748uncharacterized LOC103693748156458992964832650Rat
9364271LOC103693771uncharacterized LOC103693771158283879182854514Rat
9466192LOC103693740cytochrome b-c1 complex subunit 7 pseudogene155875934358759666Rat
9409882Matr3-ps2matrin 3, pseudogene 2157388290973886465Rat
9417610LOC103693758uncharacterized LOC103693758157231848772385670Rat
9459085LOC103693764uncharacterized LOC103693764157490991974915756Rat
9685073Mir1297microRNA 1297155684843056848503Rat
11362115LOC108352964uncharacterized LOC108352964158319152783263790Rat
11455629LOC108352970uncharacterized LOC108352970158821293388334191Rat
11356954LOC108352942uncharacterized LOC108352942155033048850348165Rat
11434381LOC108352947uncharacterized LOC108352947155520341055274301Rat
11470834LOC108352951RING finger and CHY zinc finger domain-containing protein 1 pseudogene157629335476294634Rat
11361310LOC10835304560S ribosomal protein L29 pseudogene158047350280473993Rat
11436659LOC108353006ATP synthase subunit d, mitochondrial pseudogene155721053057211782Rat
11436928LOC108352945uncharacterized LOC108352945155186004751862572Rat
11447237LOC108353040uncharacterized LOC108353040155423194754235599Rat
11450795Trnae-uuc7transfer RNA glutamic acid (anticodon UUC) 7155148538351485454Rat
11452914LOC108352963uncharacterized LOC108352963158179293381816324Rat
11427239LOC108352956uncharacterized LOC108352956157932711779349197Rat
11376868LOC108352955uncharacterized LOC108352955157749736177507913Rat
11410085LOC108352959uncharacterized LOC108352959158017539580194897Rat
11410099LOC108353042uncharacterized LOC108353042157086763970872983Rat
11379167LOC108352949uncharacterized LOC108352949156023615860255653Rat
11402272LOC108353046protein transport protein Sec61 subunit gamma pseudogene158300188783002135Rat
11379973Trnae-uuc8transfer RNA glutamic acid (anticodon UUC) 8155489080954890880Rat
11391647LOC108352944uncharacterized LOC108352944155171709651730024Rat
11393005LOC108353047uncharacterized LOC108353047158433751184349331Rat
11507603LOC108352946uncharacterized LOC108352946155210784852112526Rat
11498208LOC108352954uncharacterized LOC108352954157732467577471131Rat
11512925LOC108352966uncharacterized LOC108352966157988308779886189Rat
11484738LOC108352943uncharacterized LOC108352943155153676051563422Rat
11487989LOC108352958cytochrome c, somatic pseudogene158009335680096114Rat
11489075LOC108352965endogenous retrovirus group K member 21 Env polyprotein-like158457319084581734Rat
41354306LOC120097060uncharacterized LOC120097060157633918676341011Rat
41086981LOC120097308U6 spliceosomal RNA155884001758840119Rat
41112163LOC120096992translation initiation factor IF-2-like155414997054151117Rat
41323194LOC120097062uncharacterized LOC120097062157943056379436640Rat
41380823LOC120096996hsc70-interacting protein-like158820212788210457Rat
41087576LOC12009711540S ribosomal protein S15-like155262460752625235Rat
41204718LOC120097281U2 spliceosomal RNA156877186068772017Rat
41277989LOC120097120uncharacterized LOC120097120155426877054269387Rat
41381972LOC120096993tubulin alpha chain-like156407140364072451Rat
41169285LOC120097045GTP-binding nuclear protein Ran-like155141578451416614Rat
41251075LOC120097271small nucleolar RNA SNORA17157083639770836536Rat
41252070NEWGENE_40926764transfer RNA proline (anticodon AGG)158207672882076800Rat
41285695LOC120097042uncharacterized LOC120097042155115955151169131Rat
41325790LOC120097252small nucleolar RNA SNORA17156655180666551936Rat
41326155LOC120097228small nucleolar RNA SNORA48156366873363668876Rat
41142542LOC120097170uncharacterized LOC120097170158026663180280617Rat
41287184LOC120097257small nucleolar RNA SNORA17156867010768670234Rat
41361993LOC120097243small nucleolar RNA SNORA17157919355479193685Rat
41363119LOC120097317U6 spliceosomal RNA157755266577552761Rat
41096054LOC120093128uncharacterized LOC120093128156393710263941299Rat
41148120LOC120097109uncharacterized LOC120097109155156630551571272Rat
41148836LOC120097260small nucleolar RNA SNORA17158175643981756561Rat
41176091LOC120097266small nucleolar RNA SNORA17157169596971696057Rat
41188357LOC12009717660S ribosomal protein L13a-like154975736749758024Rat
41261712LOC120097292U6 spliceosomal RNA157300867373008779Rat
41262856LOC120097242small nucleolar RNA SNORA17155906759759067728Rat
41365366LOC120093048tRNA methyltransferase 10 homolog A-like155055783250569751Rat
41365783LOC120097247small nucleolar RNA SNORA17156575091865751049Rat
41121265LOC120097225small nucleolar RNA SNORA2/SNORA34 family157176224671762373Rat
41121747LOC120097259small nucleolar RNA SNORA17157404462274044753Rat
41189376LOC120097230small nucleolar RNA SNORA48156305046163050601Rat
41154596LOC120097113uncharacterized LOC120097113155186311051868135Rat
41155398LOC120097076uncharacterized LOC120097076158880934788819173Rat
41265548LOC120097069ATP synthase subunit g, mitochondrial-like158197168381973581Rat
41266332LOC120097278U2 spliceosomal RNA158537843785378563Rat
41101550LOC120097117uncharacterized LOC120097117155295910952960850Rat
41270046LOC120097061uncharacterized LOC120097061157847410178480713Rat
41397731LOC120097316U6 spliceosomal RNA158137324981373355Rat
41398796LOC120097040uncharacterized LOC120097040155082147550844771Rat
41070333LOC120097216small nucleolar RNA SNORA31155115922051159349Rat
41103500LOC120097287U4 spliceosomal RNA157766526677665430Rat
41127910LOC120097107ATP synthase subunit ATP5MPL, mitochondrial-like156320208063202497Rat
41159086LOC120097072uncharacterized LOC120097072158331386583364030Rat
41348002LOC120097114uncharacterized LOC120097114155190418951909465Rat
41071279LOC120097270small nucleolar RNA SNORA17158355395883554033Rat
41271476LOC120097313U1 spliceosomal RNA156228193762282097Rat
41131207LOC120097267U2 spliceosomal RNA157653365876533849Rat
41131751LOC12009699440S ribosomal protein S18-like158133040181331061Rat
41164845LOC120097049uncharacterized LOC120097049155395618653960792Rat
41352702LOC120097077uncharacterized LOC120097077158858861588620218Rat
41377666LOC120097139eukaryotic translation initiation factor 1-like157486420674864707Rat
41085385LOC120097237small nucleolar RNA SNORA17157719048977190617Rat
41109740LOC120097047uncharacterized LOC120097047155149876151512101Rat
40948418LOC120097190uncharacterized LOC120097190157495382274967542Rat
40975150LOC120097286small nucleolar RNA U3155954783759548029Rat
41341524LOC120097269small nucleolar RNA SNORA17158675373586753851Rat
40957543LOC120097141uncharacterized LOC120097141156968199469719442Rat
41000723LOC120097121uncharacterized LOC120097121155428709854296675Rat
40931825LOC120097110uncharacterized LOC120097110155154480951545331Rat
40958512LOC120097052uncharacterized LOC120097052155889457659015688Rat
41002785NEWGENE_40933816transfer RNA valine (anticodon AAC)156270754162707622Rat
41003131LOC120097119histidine--tRNA ligase, cytoplasmic-like155440661954416048Rat
40932818LOC120097171uncharacterized LOC120097171158030998280321557Rat
40933037LOC120097073uncharacterized LOC120097073158401208884035861Rat
40959529LOC120097187uncharacterized LOC120097187156649888566520540Rat
40983884LOC120097054uncharacterized LOC120097054156665172066661831Rat
40986166NEWGENE_40964154transfer RNA proline (anticodon UGG)155272918152729261Rat
40964313LOC120097044uncharacterized LOC120097044155135805951361504Rat
40989554LOC120097194U6 spliceosomal RNA156219208462192173Rat
40990485LOC120097223U1 spliceosomal RNA157612224976122407Rat
40939906LOC120097116uncharacterized LOC120097116155283995052863424Rat
40992298LOC12009704340S ribosomal protein S29-like155119379451199210Rat
40942556LOC120097218small nucleolar RNA SNORA5155128408451284223Rat
40995928LOC120097056uncharacterized LOC120097056156786285767953489Rat
40996552LOC120097046uncharacterized LOC120097046155140780651408246Rat
41311605LOC120097184uncharacterized LOC120097184155567877955691531Rat
41023963LOC120097189SNF-related serine/threonine-protein kinase-like157078688370789325Rat
41026458LOC120097310U6 spliceosomal RNA156374503163745137Rat
41315848LOC120097074uncharacterized LOC120097074158454660484561746Rat
41027949LOC120097302U1 spliceosomal RNA156946362569463786Rat
41029165LOC120097236small nucleolar RNA SNORA17158141609781416227Rat
41051620LOC120097140uncharacterized LOC120097140156950797869538198Rat
41079966LOC120097254small nucleolar RNA SNORA17156728878167288910Rat
41080237LOC120097051protein kish-A-like155894679058952210Rat
41247556LOC120097039uncharacterized LOC120097039155044361550464475Rat
41029775LOC120097309U6 spliceosomal RNA158379931683799420Rat
41029888LOC120097048uncharacterized LOC120097048155249305052501340Rat
41030389LOC120097059uncharacterized LOC120097059157557001275574783Rat
41254968LOC120097293U6 spliceosomal RNA157617301176173117Rat
41255204LOC120097311U6 spliceosomal RNA157988191979882023Rat
41054013LOC120097265small nucleolar RNA SNORA17157166663371666721Rat
41257981LOC120097142uncharacterized LOC120097142156999016870006898Rat
41059337LOC120097108uncharacterized LOC120097108155154586951566802Rat
41315464LOC120097053uncharacterized LOC120097053156138063461394655Rat
41033512LOC120097256U2 spliceosomal RNA155477002654770188Rat
41059573LOC120097112uncharacterized LOC120097112155180841851822530Rat
41300597LOC120097055uncharacterized LOC120097055156664332566653880Rat
41336497LOC120097058non-histone chromosomal protein HMG-17-like157462079774621379Rat
41336942LOC120097038uncharacterized LOC120097038154963351949645203Rat
41035228LOC120096902uncharacterized LOC120096902158254978282551605Rat
41226654LOC120097232small nucleolar RNA SNORA17156651097266511103Rat
41334176LOC120096897nucleoside diphosphate kinase B-like157898122778983942Rat
41227491LOC120097063uncharacterized LOC120097063157986770779873636Rat
41039001LOC120097075uncharacterized LOC120097075158797526887982501Rat
41304945LOC120097070uncharacterized LOC120097070158201298382033164Rat
41018907LOC120097188uncharacterized LOC120097188156747758567491791Rat
41019314LOC120097037uncharacterized LOC120097037154955623949571826Rat
41042581LOC120097041uncharacterized LOC120097041155095973950975200Rat
41309137LOC12009711140S ribosomal protein S29-like155167644851680099Rat
41022028LOC120097213small nucleolar RNA SNORD113/SNORD114 family158092711780927199Rat
41046054LOC120097303U6 spliceosomal RNA155058497450585080Rat
41022417LOC120096995eukaryotic initiation factor 4A-II-like158795316987957830Rat
41023740LOC120097057uncharacterized LOC120097057156848083468606048Rat
2504Dio1iodothyronine deiodinase 15122074285122090983Rat
68428Aqp3aquaporin 3 (Gill blood group)55623920056244718Rat
2078Ak4adenylate kinase 45116039222116099064Rat
3642Scp2sterol carrier protein 25122806949122881259Rat
3602Rps6ribosomal protein S65101371716101374576Rat
3852Tgfbr1transforming growth factor, beta receptor 156165377361710777Rat
2324Cdkn2bcyclin-dependent kinase inhibitor 2B5104009839104019082Rat
67390Orm1orosomucoid 157676663776776149Rat
61882Nr4a3nuclear receptor subfamily 4, group A, member 356236158862401489Rat
61900Gabrr1gamma-aminobutyric acid type A receptor subunit rho 154752415147561228Rat
2090Aldobaldolase, fructose-bisphosphate B56388904563902086Rat
61946Pou3f2POU class 3 homeobox 253607793036083838Rat
70919Cltaclathrin, light chain A55824425358263480Rat
69340Calb1calbindin 152937562429402532Rat
2102Ambpalpha-1-microglobulin/bikunin precursor57656809476578416Rat
2190Baatbile acid CoA:amino acid N-acyltransferase56385166863860641Rat
2865Ifnb1interferon beta 15103020969103021523Rat
2083Aladaminolevulinate dehydratase57596199375972334Rat
619748Cdh17cadherin 1752526282025314884Rat
620059Slc31a1solute carrier family 31 member 157581474475844241Rat
62005Tmeff1transmembrane protein with EGF-like and two follistatin-like domains 156291074062996494Rat
2682Gghgamma-glutamyl hydrolase53352988033552790Rat
2380Coq3coenzyme Q3 methyltransferase53542956735460613Rat
3870Tlr4toll-like receptor 458014586780159501Rat
3874Tmod1tropomodulin 156031644560393957Rat
3001Leprleptin receptor5116294409116477904Rat
69056Jak1Janus kinase 15115780248115888841Rat
62059Tesk1testis associated actin remodelling kinase 155769192257697698Rat
69426Oprk1opioid receptor, kappa 151386001613877823Rat
3210Nrdcnardilysin convertase5123755807123818910Rat
3211Muskmuscle associated receptor tyrosine kinase57305842773169696Rat
621671Ptbp3polypyrimidine tract binding protein 357431353674399439Rat
621445Klf4Kruppel like factor 457027884370283751Rat
621017LynLYN proto-oncogene, Src family tyrosine kinase51663951216755501Rat
620276Sh3gl2SH3 domain containing GRB2 like 2, endophilin A159965318999827500Rat
708451Cdk5rap2CDK5 regulatory subunit associated protein 258379228283961129Rat
631330Whrnwhirlin57682830876911945Rat
631344Abca1ATP binding cassette subfamily A member 156767826767801162Rat
631439Psip1PC4 and SFRS1 interacting protein 159784701097879280Rat
631442Cyp2j3cytochrome P450, family 2, subfamily j, polypeptide 35111219921111244987Rat
3316Pgm1phosphoglucomutase 15114595298114654728Rat
728909Pcsk9proprotein convertase subtilisin/kexin type 95121211278121233688Rat
2369Cnr1cannabinoid receptor 154840854348436099Rat
621856Rnf38ring finger protein 3855835877158467424Rat
621704Grin3aglutamate ionotropic receptor NMDA type subunit 3A56400684764206408Rat
621715Foxd3forkhead box D35114334693114337788Rat
3105Mpdzmultiple PDZ domain crumbs cell polarity complex component59576611295920531Rat
621569Hemgnhemogen56067963360698597Rat
621285Anp32bacidic nuclear phosphoprotein 32 family member B56074307760765726Rat
727868Nsmafneutral sphingomyelinase activation associated factor51951779519578773Rat
621332Il11ra1interleukin 11 receptor subunit alpha 155693182456941408Rat
631435Orc1origin recognition complex, subunit 15123324273123348375Rat
621420Nbnnibrin52945957429494152Rat
708499Stx17syntaxin 1756244613862506108Rat
708508Obp3alpha-2u globulin PGCL457484231674845858Rat
708519Brinp1BMP/retinoic acid inducible neural specific 158234850182550506Rat
620694Smu1SMU1, DNA replication regulator and spliceosomal factor55585669155875262Rat
620199Mmp16matrix metallopeptidase 1653131228031556276Rat
70905Ccnccyclin C53526682835284943Rat
62015Nfibnuclear factor I/B59675920896973092Rat
628770Dab1DAB adaptor protein 15118392953119513625Rat
620072Elp1elongator acetyltransferase complex subunit 157145333871505833Rat
621245Plaaphospholipase A2, activating protein5109428600109460373Rat
3025Lypla1lysophospholipase 151467960514708774Rat
620922Rab3bRAB3B, member RAS oncogene family5123629562123697410Rat
621870UgcgUDP-glucose ceramide glucosyltransferase57403297874065701Rat
620563Lpar1lysophosphatidic acid receptor 157322904773347874Rat
621595Vcpvalosin-containing protein55721016757229571Rat
628735Tnfsf15TNF superfamily member 1557714009977156142Rat
620940Mllt3MLLT3, super elongation complex subunit5102259075102515447Rat
620942Dnaja1DnaJ heat shock protein family (Hsp40) member A155584241455853326Rat
631423Tp53inp1tumor protein p53 inducible nuclear protein 152425398624272250Rat
621497Sdcbpsyndecan binding protein51947349919517188Rat
621723Foxe1forkhead box E156063002760632835Rat
628740Aptxaprataxin55579889655822963Rat
620980TekTEK receptor tyrosine kinase5109607077109733805Rat
621139Bsndbarttin CLCNK type accessory subunit beta5121251774121260571Rat
621157Txn1thioredoxin 157271233472724564Rat
68364Sigmar1sigma non-opioid intracellular receptor 155690415556907012Rat
727958Zfp483zinc finger protein 48357376320173780511Rat
628657Spata6spermatogenesis associated 65126593122126676557Rat
620436Cgaglycoprotein hormones, alpha polypeptide54948691549499192Rat
619820Mrpl37mitochondrial ribosomal protein L375121827892121846187Rat
619804RragaRas-related GTP binding A5101113341101114936Rat
3170Nfianuclear factor I/A5112436655112781878Rat
628753Pnrc1proline-rich nuclear receptor coactivator 154764707047657832Rat
621426Slc44a1solute carrier family 44 member 156806194168241912Rat
620454Plpp3phospholipid phosphatase 35119927085120002206Rat
621195Ptgr1prostaglandin reductase 157378400073802624Rat
621502Ssbp3single stranded DNA binding protein 35121691370121828035Rat
620327Maneamannosidase, endo-alpha54019637340218534Rat
1303188Spink4serine peptidase inhibitor, Kazal type 455605310456065029Rat
620104Gdf6growth differentiation factor 652299624623012567Rat
1307056Fhl5four and a half LIM domains 553890794138956759Rat
1305807RGD1305807hypothetical LOC29807756010694960147546Rat
1305172Snapc3small nuclear RNA activating complex, polypeptide 359781782797868494Rat
1305174Magohmago homolog, exon junction complex subunit5122639268122646650Rat
70999Decr12,4-dienoyl-CoA reductase 152941117229439054Rat
621514Gng10G protein subunit gamma 1057385612473863017Rat
619864Gabbr2gamma-aminobutyric acid type B receptor subunit 256094751761288104Rat
628650Slc24a2solute carrier family 24 member 25101499536101739337Rat
619724Tdrd7tudor domain containing 756023874260312548Rat
735162Ndufaf4NADH:ubiquinone oxidoreductase complex assembly factor 453860516938610341Rat
2325Cdkn2ccyclin-dependent kinase inhibitor 2C5124411123124416278Rat
621057Tnctenascin C57737585177460712Rat
3915Ttpaalpha tocopherol transfer protein53349753733518936Rat
708501LOC259244alpha-2u globulin PGCL357490946874912890Rat
620007Cyp2j4cytochrome P450, family 2, subfamily j, polypeptide 45111179981111207490Rat
1304814Klhl9kelch-like family member 95103333747103337931Rat
1304816Fkbp15FKBP prolyl isomerase family member 1557575078675815038Rat
1304821Oma1OMA1 zinc metallopeptidase5118083728118136980Rat
619723Unc13bunc-13 homolog B55728899957504110Rat
3334Anks6ankyrin repeat and sterile alpha motif domain containing 656130918361350596Rat
628611Elavl2ELAV like RNA binding protein 25105960872106086539Rat
620893Prkaa2protein kinase AMP-activated catalytic subunit alpha 25119807992119879987Rat
2323Cdkn2acyclin-dependent kinase inhibitor 2A5103984949103992143Rat
2239C8bcomplement C8 beta chain5119535009119572565Rat
1304595Tmem268transmembrane protein 26857697482777001457Rat
2019Aco1aconitase 155525984155315872Rat
621034Leprotleptin receptor overlapping transcript5116289843116301951Rat
621037Rps20ribosomal protein S2051681931316820475Rat
620723Zfp37zinc finger protein 3757559873275638896Rat
735206Yipf1Yip1 domain family, member 15122112144122147729Rat
735211Mup4major urinary protein 457496114374964686Rat
708548Necab1N-terminal EF-hand calcium binding protein 152835785928578642Rat
708400BspryB-box and SPRY domain containing57592739775949585Rat
2145Aqp7aquaporin 755617164956186642Rat
728889Plin2perilipin 25101156643101211738Rat
2398Cpt2carnitine palmitoyltransferase 25122664677122682126Rat
620393Pdp1pyruvate dehydrogenase phosphatase catalytic subunit 152544684325455107Rat
70957Epha7Eph receptor A754297535343128703Rat
620851Npr2natriuretic peptide receptor 255788317157901590Rat
619955Fut9fucosyltransferase 953935181539565256Rat
1304730Dcaf10DDB1 and CUL4 associated factor 1055960779559647209Rat
1304739Exosc3exosome component 355957384959579065Rat
69239Gneglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase55826718958307396Rat
2482Cyp7a1cytochrome P450 family 7 subfamily A member 151937697919386676Rat
69232Ppp3r2protein phosphatase 3, regulatory subunit B, beta56402690364027898Rat
1304660Ccl27C-C motif chemokine ligand 2755694140256948511Rat
735107Mup5major urinary protein 557520132475204903Rat
735115Col27a1collagen type XXVII alpha 1 chain57664730276765987Rat
1305203Bag1BAG cochaperone 155606849456081075Rat
61931Zfp292zinc finger protein 29254938417749468177Rat
1307528Kdm4clysine demethylase 4C58810071088306821Rat
1304693Mms22lMMS22-like, DNA repair protein53819770738313745Rat
1304697Actl7aactin-like 7a57144744771450440Rat
1306323Osgin2oxidative stress induced growth inhibitor family member 252950040629519340Rat
1306135Ifna1interferon, alpha 15103095767103098260Rat
1305550Eps15epidermal growth factor receptor pathway substrate 155124045865124146221Rat
1305917Npbwr1neuropeptides B and W receptor 151349542613496415Rat
1304709Ca8carbonic anhydrase 852130294021402395Rat
1304796Mrpl15mitochondrial ribosomal protein L1551472996614741276Rat
2943JunJun proto-oncogene, AP-1 transcription factor subunit5109894175109897268Rat
3103MosMOS proto-oncogene, serine/threonine kinase51685995716861264Rat
1305442Tm2d1TM2 domain containing 15113020760113062370Rat
1306394Mdn1midasin AAA ATPase 154705543547190426Rat
1305828Dpy19l4dpy-19 like 452435128924410932Rat
1304997Sec61bSEC61 translocon subunit beta56177359461781804Rat
1306334Ifna4interferon, alpha 45103069483103070052Rat
1307079Spag8sperm associated antigen 855790168157903894Rat
1306439Adamtsl1ADAMTS-like 1599964406100919786Rat
70987Faf1Fas associated factor 15124426032124790014Rat
1306737Aldh1b1aldehyde dehydrogenase 1 family, member B156006337060068378Rat
620900B4galt1beta-1,4-galactosyltransferase 155593561455982461Rat
1305135Akap2A-kinase anchoring protein 257253698672648524Rat
1305703Tmem38btransmembrane protein 38B56846030468496026Rat
1306999Gpx7glutathione peroxidase 75123145151123153141Rat
1306900Atp6v0d2ATPase H+ transporting V0 subunit D253333625733385354Rat
1305655Actl7bactin-like 7b57144553271446920Rat
1305656Igfbpl1insulin-like growth factor binding protein-like 156007642860091833Rat
1305067Ube2j1ubiquitin-conjugating enzyme E2, J154742251347441476Rat
1306418RasefRAS and EF hand domain containing58754890887619286Rat
1306426Ca9carbonic anhydrase 955776323457769838Rat
1307453Dnajb5DnaJ heat shock protein family (Hsp40) member B555717684057185492Rat
1309940Alg2ALG2, alpha-1,3/1,6-mannosyltransferase56176873861773297Rat
1307963Slc31a2solute carrier family 31 member 257573800875748542Rat
1305750Zdhhc21zinc finger DHHC-type palmitoyltransferase 2159722762197286866Rat
1305186Ubap1ubiquitin-associated protein 155652072256561153Rat
1307983InipINTS3 and NABP interacting protein57464839274662628Rat
1309978Frrs1lferric-chelate reductase 1-like57165591171690132Rat
1308557Ubxn2bUBX domain protein 2B51930363419333181Rat
1305190Mcart1mitochondrial carrier triple repeat 155965022759663454Rat
1307610Raver2ribonucleoprotein, PTB-binding 25115700985115780465Rat
1306529Dhcr2424-dehydrocholesterol reductase5121344637121368853Rat
3566Rgs3regulator of G-protein signaling 357602203876161895Rat
1305724Fbxl4F-box and leucine-rich repeat protein 453595580136029446Rat
1307386GemGTP binding protein overexpressed in skeletal muscle52521430925225222Rat
1307723Kif24kinesin family member 2455656101956628040Rat
1306455Bpnt23'(2'), 5'-bisphosphate nucleotidase 251777568417802570Rat
1308525Echdc2enoyl CoA hydratase domain containing 25122915874122934860Rat
68323Rab2aRAB2A, member RAS oncogene family52167621921738833Rat
1304629Acer2alkaline ceramidase 25101391830101442615Rat
1307367Zbtb5zinc finger and BTB domain containing 555924413259265461Rat
1307395PnisrPNN interacting serine and arginine rich protein53539596535422852Rat
1306460Gpr63G protein-coupled receptor 6353867254838727224Rat
1306461Usp1ubiquitin specific peptidase 15113587564113598934Rat
1310007RragdRas-related GTP binding D54737390247409369Rat
1310012Tmem8btransmembrane protein 8B55791947357948419Rat
1310024Otud6bOTU deubiquitinase 6B52818199228214486Rat
1306981Frem1Fras1 related extracellular matrix 159732127597469523Rat
1308769XpaXPA, DNA damage recognition and repair factor56043167360476438Rat
1307742Pappa1pappalysin 157849766078735873Rat
1305387Hsdl2hydroxysteroid dehydrogenase like 257444393374479104Rat
1305158Smim8small integral membrane protein 854933661749345625Rat
1305345Pars2prolyl-tRNA synthetase 2, mitochondrial5121433993121439158Rat
1305371Sox17SRY-box transcription factor 1751501666015022228Rat
1307791Akirin2akirin 254910823149122566Rat
1307783Ccne2cyclin E252428507824298258Rat
1303116Plppr1phospholipid phosphatase related 156343745763725286Rat
1303121Txndc8thioredoxin domain containing 857274972572785858Rat
1305729Lrp8LDL receptor related protein 85122563468122635434Rat
1305419Rars2arginyl-tRNA synthetase 2, mitochondrial54918151749238664Rat
1305420TrmotRNA methyltransferase O56066310660676423Rat
1306576Rpp25lribonuclease P/MRP subunit p25 like55687842056879956Rat
1304802Frmd3FERM domain containing 358776460488032261Rat
708566St18ST18 C2H2C-type zinc finger transcription factor51258249312914221Rat
1305598Gba2glucosylceramidase beta 255782238957834522Rat
1307218Pgap4post-GPI attachment to proteins GalNAc transferase 456393191663947004Rat
1333374Olr840olfactory receptor 84055808115058082109Rat
1333398Olr851olfactory receptor 85156751869167519650Rat
3280Pde4bphosphodiesterase 4B5116799827117367707Rat
1309438Map3k7mitogen activated protein kinase kinase kinase 754635697346415597Rat
1308330Megf9multiple EGF-like-domains 958399356584105622Rat
1310893Tstd2thiosulfate sulfurtransferase like domain containing 256037175160415916Rat
1309719Coro2acoronin 2A56082563060881917Rat
1310395Cavin4caveolae associated protein 456299697563004819Rat
1333384Olr848olfactory receptor 84856740215767403110Rat
1310178Cpne3copine 353301465833064004Rat
1308101Cntlncentlein59929586599576402Rat
1308030Glis1GLIS family zinc finger 15122222155122412141Rat
1308033Nol6nucleolar protein 655625991956270540Rat
1309582Zyg11azyg-11 family member A, cell cycle regulator5122935439122973766Rat
1309547Dctn3dynactin subunit 355688108556889041Rat
1560539RGD1560539similar to interferon alpha 8/6 precursor; IFNa8/6 (B6)5103476362103477211Rat
1359369Ccincalicin55820667658208563Rat
1310364Klhl32kelch-like family member 3253832123738568453Rat
1309148Dmac1distal membrane arm assembly component 158924117389243793Rat
1333133Olr844olfactory receptor 84456730562067306573Rat
1311928Slc1a7solute carrier family 1 member 75122731003122775139Rat
1359481Tceanc2transcription elongation factor A N-terminal and central domain containing 25121923959121963018Rat
1311717Ubap2ubiquitin-associated protein 255634824356437403Rat
1309790Dock7dedicator of cytokinesis 75113599371113782871Rat
1309880Tcea1transcription elongation factor A151463145414668769Rat
1310455Toxthymocyte selection-associated high mobility group box51987499420171272Rat
1310467Zcchc7zinc finger CCHC-type containing 755899255859173308Rat
1332684Olr833olfactory receptor 83355795197157952921Rat
1310820Col15a1collagen type XV alpha 1 chain56150196361607591Rat
1308355C8acomplement C8 alpha chain5119583168119637675Rat
1332606Olr836olfactory receptor 83655801960658020565Rat
1332612Olr850olfactory receptor 85056745575167456701Rat
1310425Fam221bfamily with sequence similarity 221, member B55791034657919562Rat
1311249Fam214bfamily with sequence similarity 214, member B55726083957274524Rat
1310856Zfyve9zinc finger FYVE-type containing 95123370677123529699Rat
1311354Ndufb6NADH:ubiquinone oxidoreductase subunit B655540054355410110Rat
1311359Slc35a1solute carrier family 35 member A154922559949248405Rat
1311363Ptpn3protein tyrosine phosphatase, non-receptor type 357190852072027323Rat
1311367Snx30sorting nexin family member 3057468390274813013Rat
1309757Cd72Cd72 molecule55769736157704980Rat
1312045Tex10testis expressed 1056276223062808373Rat
1310951RGD1310951similar to RIKEN cDNA E130308A1957449177774636170Rat
1310846Slc26a7solute carrier family 26 member 752788440028021865Rat
1311508Osbpl9oxysterol binding protein-like 95123819106123962213Rat
1311303Prpf4pre-mRNA processing factor 457585993475873924Rat
1310336Ccl19C-C motif chemokine ligand 1955696336456965308Rat
1310339Hacd43-hydroxyacyl-CoA dehydratase 45102887597102915376Rat
1333321Olr847olfactory receptor 84756727844467279397Rat
1311774Btf3l4basic transcription factor 3-like 45123569059123587593Rat
1309085Ndufaf6NADH:ubiquinone oxidoreductase complex assembly factor 652414771224171981Rat
1310770Cachd1cache domain containing 15115411833115637312Rat
1310773Lingo2leucine rich repeat and Ig domain containing 255037074451687252Rat
1311996Ccl21C-C motif chemokine ligand 2155698055756981661Rat
1312000Asphaspartate-beta-hydroxylase52260387922814107Rat
1312029Plekhf2pleckstrin homology and FYVE domain containing 252409107724106758Rat
1311787Mysm1myb-like, SWIRM and MPN domains 15109761345109826652Rat
1310743Zfp618zinc finger protein 61857639851476564837Rat
1311434Ctnnal1catenin alpha-like 157151434071569431Rat
1311342Cdc26cell division cycle 2657584485275859837Rat
1309045Ifnkinterferon kappa54973207349734281Rat
1559493Lexmlymphocyte expansion molecule5121375998121401869Rat
1333279Olr843-psolfactory receptor pseudogene 84356726430467264919Rat
1332747Olr839olfactory receptor 83955806707858068034Rat
1332764Olr841olfactory receptor 84156722777467228733Rat
1309006Tmem68transmembrane protein 6851649405416524842Rat
1311633Slc7a13solute carrier family 7 member 1353327741633298105Rat
1310976Usp45ubiquitin specific peptidase 4553531862135392090Rat
1560696Mob3bMOB kinase activator 3B54954180449737934Rat
1549780Xkr4XK related 451589618816297733Rat
1310641Cfap206cilia and flagella associated protein 20654925439949299145Rat
1306507Rad54bRAD54 homolog B52503088525104616Rat
1311027Dnai4dynein axonemal intermediate chain 45117787398117876140Rat
1309900Dnajc6DnaJ heat shock protein family (Hsp40) member C65116120069116283448Rat
1309460Ddx58DEXD/H-box helicase 5855532122955369947Rat
1306510Zfp189zinc finger protein 18956387259663884348Rat
1306860Tbc1d2TBC1 domain family, member 256088411460931717Rat
1305227Smc2structural maintenance of chromosomes 256680688266853478Rat
1305229Frmpd1FERM and PDZ domain containing 155944307659545125Rat
1309796Dmrta1DMRT-like family A15104415893104422433Rat
1310694Bnc2basonuclin 259867907199079742Rat
1308173Dmrta2DMRT-like family A25124805883124811694Rat
1305238Trim32tripartite motif-containing 3257900513979016615Rat
1311514Trim14tripartite motif-containing 1456080003260825481Rat
1311410RngttRNA guanylyltransferase and 5'-phosphatase54770692947913297Rat
1308008Mrpl50mitochondrial ribosomal protein L5056386743763872591Rat
1309367Wdr31WD repeat domain 3157589707475917461Rat
1305797Ttc39btetratricopeptide repeat domain 39B59760332997708103Rat
1306483Galtgalactose-1-phosphate uridylyltransferase55692703956930284Rat
1306799Usp24ubiquitin specific peptidase 245121080687121210321Rat
1311425Ifna2interferon alpha 25103258617103259195Rat
1305490Runx1t1RUNX1 partner transcriptional co-repressor 152718767427338070Rat
1306225Pip4p2phosphatidylinositol-4,5-bisphosphate 4-phosphatase 252825982128307225Rat
1309291RGD1309291similar to RIKEN cDNA 4930547C1056699808367000642Rat
1309308Ufl1Ufm1-specific ligase 153896272138995134Rat
1308487Kif12kinesin family member 1257659620476603261Rat
1310087Fktnfukutin56833980368396412Rat
1310088Atp6v1g1ATPase H+ transporting V1 subunit G157696146276967642Rat
1310095Zfp353zinc finger protein 3535105075038105077359Rat
1309498Pigophosphatidylinositol glycan anchor biosynthesis, class O55724472157256252Rat
1306247Tln1talin 155778767057817900Rat
1308974Melkmaternal embryonic leucine zipper kinase55854039358600937Rat
1308489Dennd4cDENN domain containing 4C5101272298101369529Rat
1306966Susd1sushi domain containing 157415765374281171Rat
1307635Kank4KN motif and ankyrin repeat domains 45113401491113465526Rat
1305960Txndc12thioredoxin domain containing 125123587854123612886Rat
1305968Chmp5charged multivesicular body protein 555608138556098529Rat
1308202AknaAT-hook transcription factor57677741576824380Rat
1309987Hook1hook microtubule-tethering protein 15110824501110887791Rat
1308529Ttc4tetratricopeptide repeat domain 45121444714121462385Rat
1310114Mtapmethylthioadenosine phosphorylase5103873020103939406Rat
1308165Msantd3Myb/SANT DNA binding domain containing 356286602262892444Rat
1309176Erp44endoplasmic reticulum protein 4456251655062610762Rat
1309821Myorgmyogenesis regulating glycosidase55665425756664467Rat
1309630Gja10gap junction protein, alpha 1054699496447002902Rat
1307853Pm20d2peptidase M20 domain containing 254756605947586334Rat
1309346Rb1cc1RB1-inducible coiled-coil 151316164813225560Rat
1305465Fbxo10F-box protein 1055929701659343429Rat
1310313Tmem59transmembrane protein 595121962507121983625Rat
1305771Casp8ap2caspase 8 associated protein 254701450147052276Rat
1306630Cc2d1bcoiled-coil and C2 domain containing 1B5123353289123367343Rat
1309237Tle1TLE family member 1, transcriptional corepressor58585182785934806Rat
1308845Reckreversion-inducing-cysteine-rich protein with kazal motifs55810291558169513Rat
1308851Grhprglyoxylate and hydroxypyruvate reductase55923417959243614Rat
1308285Stoml2stomatin like 255725622757259824Rat
1307658Rbm12bRNA binding motif protein 12B52559740525610324Rat
1309843Slc35d1solute carrier family 35 member D15117928628117981289Rat
1310277Nfx1nuclear transcription factor, X-box binding 155610494556162912Rat
1311383Slc5a9solute carrier family 5 member 95126709762126733468Rat
1307814Zyg11bzyg-11 family member B, cell cycle regulator5122985548123042735Rat
1308059Lurap1lleucine rich adaptor protein 1-like59536200595409439Rat
1311757Rgp1RGP1 homolog, RAB6A GEF complex partner 155783446757843087Rat
1308457Orc3origin recognition complex, subunit 354912375849181552Rat
1310681Cibar1CBY1 interacting BAR domain containing 152561399325632440Rat
1305270ToporsTOP1 binding arginine/serine rich protein, E3 ubiquitin ligase55538803355399937Rat
1308958Tmem245transmembrane protein 24557157095271647915Rat
1308910Hint2histidine triad nucleotide binding protein 255790461357906868Rat
1308919Lrrc42leucine rich repeat containing 425122014678122035792Rat
1309167Ripk2receptor-interacting serine-threonine kinase 252963080629662804Rat
1308973Ncbp1nuclear cap binding protein subunit 156041602360449004Rat
1308815Alg6ALG6, alpha-1,3-glucosyltransferase5114404972114454440Rat
1305274Coa7cytochrome c oxidase assembly factor 75123069356123080942Rat
1305286Plag1PLAG1 zinc finger51690205716956727Rat
1309953Tgs1trimethylguanosine synthase 151652486416558399Rat
1310592Ints8integrator complex subunit 852429554224344642Rat
1306148EcpasEcm29 proteasome adaptor and scaffold57360174573714026Rat
1310138Tut4terminal uridylyl transferase 45123201723123306582Rat
1306195RGD1306195similar to RAN protein55445600554457381Rat
1308831Creb3cAMP responsive element binding protein 355781783557823171Rat
1310044Itgb3bpintegrin subunit beta 3 binding protein5114460217114525538Rat
1311734Wwp1WW domain containing E3 ubiquitin protein ligase 153309237933185887Rat
1310376Arhgef39Rho guanine nucleotide exchange factor 3955775250957756079Rat
1560884Ccdc171coiled-coil domain containing 17159791996598403853Rat
1559864Phf24PHD finger protein 2455714342857171054Rat
1562865Bach2BTB domain and CNC homolog 254663233846982676Rat
1561387Fam205cfamily with sequence similarity 205, member C55708730557093191Rat
1560481Esrp1epithelial splicing regulatory protein 152442761124482157Rat
1562060Sdr16c6short chain dehydrogenase/reductase family 16C, member 651709520817118713Rat
1560290Sntg1syntrophin, gamma 15998055010794666Rat
1359704Ift74intraflagellar transport 745109460372109563839Rat
1563046Cer1cerberus 1, DAN family BMP antagonist59730642797309783Rat
68946Penkproenkephalin51718379917189160Rat
1561242Cyp2j16cytochrome P450, family 2, subfamily j, polypeptide 165111089438111138918Rat
1564021RGD1564021similar to high-mobility group box 159494831294948698Rat
1562449Faxcfailed axon connections homolog, metaxin like GST domain containing53548013735539741Rat
1562450Atp6v1hATPase H+ transporting V1 subunit H51437902914484703Rat
1563403Fam110bfamily with sequence similarity 110, member B51878936218929647Rat
1561195RGD1561195similar to ribosomal protein L3158108325981083651Rat
1560284Spaca1sperm acrosome associated 154852540648540676Rat
1565225Ifna16l1interferon, alpha 16-like 15103216368103216984Rat
1562958Rad23bRAD23 homolog B, nucleotide excision repair protein57009023270128340Rat
1311921Chd7chromodomain helicase DNA binding protein 752181200721995358Rat
1560027Elavl4ELAV like RNA binding protein 45125056848125200543Rat
1359688Nipsnap3bnipsnap homolog 3B56763764467669698Rat
1563227Zfp352zinc finger protein 3525104946243104948087Rat
1561488Dnajc25DnaJ heat shock protein family (Hsp40) member C2557382556573847878Rat
1563467Cdcp2CUB domain containing protein 25121877581121894203Rat
1561162Srsf12serine and arginine rich splicing factor 1254760652647631509Rat
1560983RGD1560983RGD15609835106906066106907230Rat
1565671Dnai1dynein, axonemal, intermediate chain 155673017956800926Rat
1562988Epb41l4berythrocyte membrane protein band 4.1 like 4B57169170671852039Rat
1561150RGD1561150similar to CPN10-like protein5107131587107131895Rat
1565773Polr1eRNA polymerase I subunit E55927945659295346Rat
1560251Caap1caspase activity and apoptosis inhibitor 15109313253109414323Rat
1560252Ccdc107coiled-coil domain containing 10755774950257752920Rat
1562337Mier1MIER1 transcriptional regulator5117876012117927592Rat
1564095RGD1564095similar to 60S acidic ribosomal protein P251255128712552204Rat
1563085Rmdn1regulator of microtubule dynamics 153307026733093922Rat
1559919Sit1signaling threshold regulating transmembrane adaptor 155774021257741838Rat
1563215Cyp2j10cytochrome P450, family 2, subfamily j, polypeptide 105110960319110995220Rat
1560994Gm5471predicted pseudogene 547152109854621099214Rat
1564278RGD1564278similar to splicing-related factor RNPS152462980724632144Rat
1563359Invsinversin56261091662763813Rat
1561916RGD1561916similar to testes development-related NYD-SP22 isoform 155666616056678799Rat
1359312Ifna5interferon, alpha 55103187852103188430Rat
1310485Slc46a2solute carrier family 46, member 257480022674808128Rat
1559469Ror1receptor tyrosine kinase-like orphan receptor 15114744311115088155Rat
1562410Dppa3-ps2developmental pluripotency-associated 3, pseudogene 258809741888098963Rat
1562001Galnt12polypeptide N-acetylgalactosaminyltransferase 1256138457561413346Rat
1334264Olr837olfactory receptor 83755803253558033482Rat
1311932Dynlt5dynein light chain Tctex-type family member 55117735509117758221Rat
1311936Rnf20ring finger protein 2056397606364001754Rat
1359108RGD1359108similar to RIKEN cDNA 3110043O2154976634049791434Rat
1560146RGD1560146similar to hypothetical protein MGC348375111342381111411576Rat
1560921Dmrtb1DMRT-like family B with proline-rich C-terminal, 15122444853122452483Rat
1562265RGD1562265similar to ribosomal protein S1254361254543612943Rat
1333470Olr835-psolfactory receptor pseudogene 83555801380858014421Rat
1560943Arid3cAT-rich interaction domain 3C55689004256895888Rat
1334138Olr853olfactory receptor 85356758930667590244Rat
1562123Zfp462zinc finger protein 46256967008569810729Rat
1561090Ptprdprotein tyrosine phosphatase, receptor type, D59004699390698977Rat
1334076Olr838olfactory receptor 83855804633058047286Rat
1303100Cntfrciliary neurotrophic factor receptor55682344856861075Rat
1559904Virmavir like m6A methyltransferase associated52496120825024660Rat
1559479Tpm2tropomyosin 255777091957780278Rat
1559786CzibCXXC motif containing zinc binding protein5122648333122657767Rat
1310735Trmt10btRNA methyltransferase 10B55954884559572529Rat
1549749Cfap418cilia and flagella associated protein 41852399639524015609Rat
1311126Ttc39atetratricopeptide repeat domain 39A5124165102124204973Rat
1311129Prpf38apre-mRNA processing factor 38A5123312461123324160Rat
1332920Olr854olfactory receptor 85457358268673583627Rat
1359532Acnat2acyl-coenzyme A amino acid N-acyltransferase 256375326963757521Rat
1563056RGD1563056similar to hypothetical protein54931678449329164Rat
1333724Olr834olfactory receptor 83455796139157962329Rat
1311943NansN-acetylneuraminate synthase56078044160797583Rat
1333551Olr852olfactory receptor 85256755571867556668Rat
1332933Olr845olfactory receptor 84556733715267340910Rat
1560180RGD1560180similar to enolase 1, alpha non-neuron57823847878242959Rat
1334211Olr846-psolfactory receptor pseudogene 84656733739567338021Rat
1359429FggyFGGY carbohydrate kinase domain containing5110398866110786019Rat
1562259RGD1562259similar to 40S ribosomal protein S2055786762857868145Rat
1560173Ndc1NDC1 transmembrane nucleoporin5122155992122202295Rat
1359584LOC298139similar to RIKEN cDNA 2310003M0158769273387706183Rat
1311849Focadfocadhesin5102564560102886587Rat
1561518Ttc22tetratricopeptide repeat domain 225121401973121423130Rat
1559441RGD1559441similar to MIC2L152472267224769149Rat
1303023Nudt2nudix hydrolase 255662826556643104Rat
1586167Tmem67transmembrane protein 6752553645825589378Rat
1560729RGD1560729similar to ribosomal protein S245104729321104730083Rat
1563440Mroh7maestro heat-like repeat family member 75121463826121509233Rat
1565350ShbSH2 domain containing adaptor protein B55967806659785443Rat
1565362PatjPATJ, crumbs cell polarity complex component5113061985113364807Rat
1585791LOC680998hypothetical protein LOC68099856372743963729005Rat
1585792LOC680997similar to Kinesin-like protein KIF1C (Kinesin-like protein KIF1D)51090616110908936Rat
1586081LOC366349similar to 60S ribosomal protein L23a54950771649508319Rat
1586082LOC366345similar to BCL2/adenovirus E1B 19kDa-interacting protein 1, NIP2 isoform beta54827942748281466Rat
1585836LOC680953similar to RIKEN cDNA G430041M0151010664210108431Rat
1586088LOC366320similar to GA binding protein transcription factor, beta subunit 2 isoform beta 252959621329605030Rat
1586091LOC366312similar to 60S ribosomal protein L1152413611524136752Rat
1586092LOC366310pseudogene for small nuclear RNA U3 (H3.9)52206501822065142Rat
1585101LOC691313similar to Caspase-3 precursor (CASP-3) (Apopain) (Cysteine protease CPP32) (Yama protein) (CPP-32) (SREBP cleavage activity 1) (SCA-1) (LICE) (IRP)53455824334559081Rat
1585262Hdhd3haloacid dehalogenase-like hydrolase domain containing 357595130875954775Rat
1586095LOC366301similar to proteasome 26S non-ATPase subunit 1251362624113708195Rat
1586096Pcmtd1protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 151228471112355680Rat
1359475Pole3DNA polymerase epsilon 3, accessory subunit57597394175977175Rat
1586416LOC688684similar to 60S ribosomal protein L325120631482120632245Rat
1587638LOC688541similar to protein disulfide isomerase-associated 558781125787866725Rat
1566134RGD1566134similar to alpha-2u-globulin57520132475224797Rat
1583724LOC500492similar to Interferon alpha-1 precursor5103320390103322719Rat
1583726LOC500476similar to heat shock protein 858201034882012966Rat
1583727LOC500473similar to alpha-2u globulin PGCL257498681374990071Rat
1583730LOC500460similar to olfactory receptor Olr84156724174967242708Rat
1583731Ankrd6ankyrin repeat domain 654719798147343183Rat
1583733Lrrc69leucine rich repeat containing 6952802359128181963Rat
1586696Hspd1-ps10heat shock protein 1, pseudogene 1057372826073730198Rat
1584099LOC688867similar to cisplatin resistance-associated overexpressed protein54965348749655419Rat
1584073Tex48testis expressed 4857701716277033720Rat
1584718LOC681025hypothetical protein LOC68102556376466663786264Rat
1586646Shoc1shortage in chiasmata 157386442373956487Rat
1583723LOC500494similar to Glycylpeptide N-tetradecanoyltransferase 1 (Peptide N-myristoyltransferase 1) (Myristoyl-CoA:protein N-myristoyltransferase 1) (NMT 1) (Type I N-myristoyltransferase)5103658873103662295Rat
1583669Glipr2GLI pathogenesis-related 255817041758200947Rat
1563572Tstd3thiosulfate sulfurtransferase like domain containing 353529465235304101Rat
1564505Angptl3angiopoietin-like 35113703007113710044Rat
1586797Capns1-ps1calpain, small subunit 1, pseudogene 155029456450297529Rat
1586398LOC689902hypothetical protein LOC68990259519946895200056Rat
1586399LOC689901similar to TGF beta-inducible nuclear protein 153789234137897149Rat
1583722LOC500497similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)5105085925105111382Rat
1587377LOC298615hypothetical pseudogene on chromosome 5q2356660632766608257Rat
1587526LOC689854similar to H/ACA ribonucleoprotein complex subunit 4 (Dyskerin) (Nucleolar protein family A member 4) (snoRNP protein DKC1) (Nopp140-associated protein of 57 kDa) (Nucleolar protein NAP57)59432124594322841Rat
1583223Nipsnap3anipsnap homolog 3A (C. elegans)56761399367625067Rat
1564956RGD1564956similar to calcium binding protein P2256857089468571875Rat
1587570Rps4x-ps3ribosomal protein S4, X-linked, pseudogene 35126842634126843859Rat
1587579Skint1selection and upkeep of intraepithelial T cells 15126786469126814599Rat
1586146Rgs20regulator of G-protein signaling 2051448432014614321Rat
1565999Sdr16c5short chain dehydrogenase/reductase family 16C, member 551701881317043974Rat
1566327Skint4selection and upkeep of intraepithelial T cells 45126878834126909044Rat
1564809Fsd1lfibronectin type III and SPRY domain containing 1-like56825887768334931Rat
1563460LOC500475similar to hypothetical protein 4933430I1757597729676002179Rat
1563375RGD1563375similar to small nuclear ribonucleoparticle-associated protein59365006293650836Rat
1564200Clvs1clavesin 152240838422604281Rat
1564981RGD1564981similar to Nonspecific lipid-transfer protein, mitochondrial precursor (NSL-TP)51660859516609025Rat
1564412Rnf183ring finger protein 18357587711175886253Rat
1563332Eqtnequatorin5109734495109762048Rat
1562799Cylc2cylicin 256555432065576251Rat
1565480Ube2uubiquitin conjugating enzyme E2 U5115118234115187296Rat
1565364Cngb3cyclic nucleotide gated channel subunit beta 353274698832995121Rat
1561827RGD1561827similar to Interferon alpha-1 precursor5103196737103197803Rat
1584958Bend5BEN domain containing 55126290648126336662Rat
1584966LOC313182similar to SEC24 related gene family, member C57139498671407245Rat
1563301RGD1563301similar to 40S ribosomal protein S1652152477121525259Rat
1565065Ifneinterferon, epsilon5103538001103627561Rat
1583986LOC690187similar to TGF beta-inducible nuclear protein 1 (CDK105 protein)59780175197802605Rat
1583529Cks1lCDC28 protein kinase regulatory subunit 1-like5106982447106983199Rat
1583530Alkal1ALK and LTK ligand 151301972913049913Rat
1559679RGD1559679similar to Interferon alpha-1 precursor5103300554103306107Rat
1563405RGD1563405similar to protein tyrosine phosphatase 4a251753051517532157Rat
1562532RGD1562532hypothetical gene supported by BC0790575118000865118064520Rat
1561260Triqktriple QxxK/R motif containing52639151126464422Rat
1565372RGD1565372similar to Ubiquitin-conjugating enzyme E2 C (Ubiquitin-protein ligase C)51899814819001967Rat
1561246RGD1561246similar to put. precursor MuIFN-alpha 55103144519103145654Rat
1561252RGD1561252similar to Ubiquitin carboxyl-terminal hydrolase isozyme L3 (Ubiquitin thiolesterase L3)57603749876038593Rat
1584919LOC366436similar to Beta-enolase (2-phospho-D-glycerate hydro-lyase) (Muscle-specific enolase) (MSE) (Skeletal muscle enolase) (Enolase 3)5124325978124327290Rat
1584921LOC366424similar to NADH dehydrogenase (ubiquinone) Fe-S protein 25118333499118337190Rat
1584923LOC366414similar to 40S ribosomal protein S7 (S8)5105902114105902692Rat
1584925LOC366410similar to RIKEN cDNA 4933403M225104595779104597302Rat
1565647Cyld-ps1cylindromatosis (turban tumor syndrome), pseudogene 151520207415205290Rat
1565236Pax5paired box 555876333458945719Rat
1565987RGD1565987similar to F-box and leucine-rich repeat protein 1859546048095464873Rat
1565988RGD1565988similar to Chain A, Bhmt From Rat Liver53036296530390524Rat
1564957Sgip1SH3GL interacting endocytic adaptor 15117536752117734593Rat
1594316LOC678911similar to 40S ribosomal protein S656668085366681691Rat
1586079LOC366365hypothetical LOC36636555960217759607812Rat
1586080LOC366355similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)55313501053136103Rat
1586075Cct6a-ps4chaperonin containing Tcp1, subunit 6A (zeta 1), pseudogene 457373065473732638Rat
1586077LOC366369similar to K+ channel tetramerization protein56651324066514662Rat
1591391LOC685622similar to non-SMC element 1 homolog5114291743114292689Rat
1589969LOC689609similar to 60S ribosomal protein L958836086588361547Rat
1588668Fam219afamily with sequence similarity 219, member A55667927256729959Rat
1592786LOC682958similar to keratin complex 1, acidic, gene 185118885696118887657Rat
1591357Kti12KTI12 chromatin associated homolog5123601059123602581Rat
1586071LOC366396similar to ribosomal protein S1259773158297731984Rat
1586073LOC366391hypothetical LOC36639159302161393023608Rat
1586184LOC298727similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)57709206177094437Rat
1592300Cnbd1cyclic nucleotide binding domain containing 153223400332606765Rat
1592267LOC689495similar to ribosomal protein S1858725020087250683Rat
1592281LOC689481similar to ribosomal protein S1255696719256987008Rat
1591090Calr4calreticulin 45123986870124022436Rat
1592194LOC690770similar to heterogeneous nuclear ribonucleoprotein K55181298851817585Rat
1592089LOC298257similar to TBC1 domain family, member 55111564652111573058Rat
1592090LOC298245similar to Nhp2 non-histone chromosome protein 2-like 15107912017107912407Rat
1591027LOC690801similar to heat shock protein 855316325753165307Rat
1591038LOC689589hypothetical protein LOC6895895124276074124295881Rat
1585925LOC679664similar to Peptidyl-prolyl cis-trans isomerase A (PPIase) (Rotamase) (Cyclophilin A) (Cyclosporin A-binding protein) (P31) (p1B15)59961185299612369Rat
1588818LOC688470similar to ribosomal protein L2452454271424543178Rat
1588799LOC688489similar to alpha2u globulin57505917075061471Rat
1585621LOC683573similar to response gene to complement 3258428089784281785Rat
1585888LOC680901hypothetical protein LOC6809015105313273105321698Rat
1587477FancgFA complementation group G55723028757240067Rat
1584701Acnat1acyl-coenzyme A amino acid N-acyltransferase 156379665163801601Rat
1589037LOC685849hypothetical protein LOC68584957266057372669438Rat
1589861Tmem215transmembrane protein 21555561256855615828Rat
1587828LOC685946similar to PRAME family member DJ1198H6.25116594690116601043Rat
1590403Tnfsf8TNF superfamily member 857725388177277078Rat
1359194Fam151afamily with sequence similarity 151, member A5121514804121527555Rat
1589875LOC690903similar to Interferon alpha-1 precursor5103104672103105585Rat
1589883Prdm13PR/SET domain 1353522081535233641Rat
1584843LOC502977similar to cytoplasmic beta-actin5120658714120659243Rat
1584846LOC502949similar to Sorbitol dehydrogenase (L-iditol 2-dehydrogenase)56054795960551393Rat
1589795LOC690990similar to 60S ribosomal protein L23a55651206356512765Rat
1590957LOC690877hypothetical protein LOC69087755545244255453652Rat
1589840LOC690941similar to ribosomal protein L2455578299955783468Rat
1589947Vom2r-ps76vomeronasal 2 receptor, pseudogene 7658869625688791737Rat
1589948LOC689630hypothetical protein LOC68963053510828035108914Rat
1584848LOC502938similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand binding protein) (hnRNP core protein A1) (HDP-1) (Topoisomerase-inhibitor suppressed)51085591210856695Rat
1583685Saxo1stabilizer of axonemal microtubules 15100937134101093308Rat
1561825Efcab7EF-hand calcium binding domain 75114525403114576130Rat
1589924LOC689654similar to Elongation factor 1-gamma (EF-1-gamma) (eEF-1B gamma)58926144489263004Rat
1587537LOC689843similar to Aldose reductase-related protein 2 (AR) (Aldehyde reductase) (Fibroblast growth factor regulated protein) (FR-1 protein)59428666894291222Rat
1584049LOC690119similar to ADP-ribosylation factor-like protein 654284114642841746Rat
1564074Fyb2FYN binding protein 25119677116119800911Rat
1585166LOC690046hypothetical protein LOC69004654026254740295229Rat
1587460Atp8b5pATPase, class I, type 8B, member 5, pseudogene55750589757620065Rat
61902Gabrr2gamma-aminobutyric acid type A receptor subunit rho 254744528047489929Rat
1588220Hspd1-ps14heat shock protein 1, pseudogene 145104129384104131678Rat
1592688Rusc2RUN and SH3 domain containing 255762839757675524Rat
1592689Chchd7coiled-coil-helix-coiled-coil-helix domain containing 751695708116969388Rat
1596535LOC683961similar to ribosomal protein S1355645712156457669Rat
1596128Tmem64transmembrane protein 6452869894728745384Rat
1594560Abitramactin binding transcription modulator57150585371524224Rat
1594562LOC298010similar to Carnitine acetyltransferase56952910069531269Rat
1597398Ldlrad1low density lipoprotein receptor class A domain containing 15121984245122000941Rat
1598345LOC297793similar to Aspartate aminotransferase, mitochondrial precursor (Transaminase A) (Glutamate oxaloacetate transaminase 2)51221532912216562Rat
1596413Hspb11heat shock protein family B (small), member 115122035588122062421Rat
1597451Cyb5rlcytochrome b5 reductase-like5121846223121868287Rat
1597387Cyc1-ps1cytochrome c-1, pseudogene 158113645281138332Rat
1597419LOC689067similar to DnaJ-like protein 252781036927811537Rat
1595256Sumo4small ubiquitin-like modifier 451509932215099913Rat
1595093L1td1LINE-1 type transposase domain containing 15113379808113386088Rat
1598323Atg4cautophagy related 4C, cysteine peptidase5113867218113935534Rat
1593542Shisal2ashisa like 2A5123110547123126842Rat
1591722Lrrc19leucine rich repeat containing 195109497503109502488Rat
1593266Tyrp1tyrosinase-related protein 159528098295299516Rat
1593269LOC298125similar to 60S ribosomal protein L1358078316180783785Rat
1593270LOC298117similar to Tubulin alpha-6 chain (Alpha-tubulin 6)57767917177681447Rat
1593272LOC298111alpha2u globulin57531171375316792Rat
1592335LOC689426similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 258551439885523157Rat
1594034Dcaf12DDB1 and CUL4 associated factor 1255646041856482171Rat
1588987Svep1sushi, von Willebrand factor type A, EGF and pentraxin domain containing 157281120072988813Rat
1593494LOC689370similar to Eukaryotic translation initiation factor 5 (eIF-5)53067638330677491Rat
1596808Tomm5translocase of outer mitochondrial membrane 555936236059365217Rat
1594826Ube2r2ubiquitin-conjugating enzyme E2R 255628660456345160Rat
1595137LOC685311similar to Histidine triad nucleotide-binding protein 1 (Adenosine 5-monophosphoramidase) (Protein kinase C inhibitor 1) (Protein kinase C-interacting protein 1) (PKCI-1)56863483968635405Rat
1591051Nkain3Sodium/potassium transporting ATPase interacting 353361372034310090Rat
1591738LOC680462similar to ribosomal protein S245103343786103344309Rat
1597334Lyrm2LYR motif containing 254719819247200470Rat
1593804LOC685453hypothetical protein LOC6854535113944483113964565Rat
1588696Skint8selection and upkeep of intraepithelial T cells 85126764502126773125Rat
1593555LOC689308similar to cyclic nucleotide gated cation channel52971705229718455Rat
1596467Tal2TAL bHLH transcription factor 256841101268417569Rat
1597763LOC685119similar to DnaJ (Hsp40) homolog, subfamily B, member 651687884816879742Rat
1597473LOC689013similar to Protein FAM57B5121681560121682371Rat
1596713Rp1RP1, axonemal microtubule associated51512110415582363Rat
1597991LOC681281similar to Superoxide dismutase [Mn], mitochondrial precursor56625852666259065Rat
1598042LOC681229similar to family with sequence similarity 51, member A1 homolog56573527265735956Rat
1594682LOC690581similar to chondroitin sulfate GalNAcT-254892507248927897Rat
1597743LOC685139similar to BWK-15111562436111563265Rat
1597744LOC685138similar to ribosomal protein S2356800625968006756Rat
1594697LOC690563similar to SET translocation54889456548895728Rat
1596418LOC685279similar to zinc finger protein 65251787251017899024Rat
2301013Sec61glSEC61 gamma subunit-like55558521355585625Rat
2320392LOC100364773hypothetical LOC10036477359323345393237397Rat
2318060Fam166bfamily with sequence similarity 166, member B55767553757680133Rat
2318103LOC100362485NHP2 ribonucleoprotein homolog51392485214056332Rat
2318120LOC100362468ChaC, cation transport regulator-like 258285086782862378Rat
2318140LOC100362448hypothetical LOC1003624485114217624114218000Rat
2318732LOC100362151argonaute 251102054911023395Rat
2318778LOC100362104mitochondrial ribosomal protein L3052944778629448371Rat
2320072LOC100361493hypothetical LOC10036149352514896325152683Rat
2320086LOC100361479hypothetical LOC10036147957439202074393768Rat
2318318LOC100362368splicing factor, arginine/serine-rich 10-like58161556381658762Rat
2318341LOC100362345hypothetical protein LOC1003623455103767094103767986Rat
2318359LOC100362326TIP41, TOR signalling pathway regulator-like51245487912455761Rat
2318973LOC100362007protein phosphatase 1, catalytic subunit, gamma-like53045623330458067Rat
2318487LOC100362298ribosomal protein S18-like5112997100112997655Rat
2320342Astn2astrotactin 257875814279744021Rat
2320512LOC100361251developmental pluripotency-associated protein 3-like56136001661360478Rat
2322103LOC100360453chromobox homolog 3-like56828055868281429Rat
2321337LOC100360821rCG55159-like55719993157203964Rat
2321393LOC100364265ribosomal protein L19-like51688089916898782Rat
2321512LOC100360746adaptor-related protein complex AP-4, sigma 151908004319081080Rat
2321596Rnf11l1ring finger protein 11-like 15124212433124243125Rat
2323040LOC100363405hypothetical LOC10036340557493033574960075Rat
2323083LOC100359962mitochondrial malate dehydrogenase-like55067273950676819Rat
2323128LOC100359916heterogeneous nuclear ribonucleoprotein K-like55866832658670222Rat
2322518LOC100360232hypothetical LOC10036023254222778342228049Rat
2323226LOC100363317signal peptidase complex subunit 2 homolog5106913633106915036Rat
2321090LOC100360970glutathione peroxidase 856984410869844745Rat
2323278Hrct1histidine rich carboxyl terminus 155798240957983186Rat
2322670LOC100360179zinc finger, FYVE domain containing 20-like55279522552797778Rat
2321121LOC100360939rCG21417-like52378676823787484Rat
2320471Fam205afamily with sequence similarity 205, member A55706573957071880Rat
2323431LOC100363209brain expressed X-linked 2-like57350552773505906Rat
2324327LOC100362631PEST proteolytic signal containing nuclear protein-like53584625835848205Rat
2324467Izumo3IZUMO family member 35106874321106876978Rat
2324484LOC100362571hypothetical LOC10036257158426997084278377Rat
2324520LOC100362534K(lysine) acetyltransferase 2B-like53542640735428184Rat
2324538LOC100362516Obg-like ATPase 156660184566602611Rat
2325348Mir101amicroRNA 101a5115966332115966406Rat
2325356Mir873microRNA 87355135691951356995Rat
2325363Mir872microRNA 8725109539086109539166Rat
2325370Mir207microRNA 20755584280655842883Rat
2325391Mir31microRNA 315103599038103599143Rat
2325411Mir761microRNA 7615123776534123776609Rat
2325412Mir876microRNA 87655133719151337269Rat
2325417Mir455microRNA 45557668931376689390Rat
2324063LOC100362795OMA1 homolog, zinc metallopeptidase-like58691306886915146Rat
2325586Mir32microRNA 3257159608371596152Rat
2324113LOC100362745zinc finger protein 101-like58687095386873370Rat
2324157LOC100362701rCG31968-like56937553669376103Rat
4888605Mir3554microRNA 35545103599032103599149Rat
2324587LOC100363867LRRGT00106-like5121870102121870527Rat
2324815Acot11acyl-CoA thioesterase 115121523833121581699Rat
2324828LOC100363061proteasome 26S non-ATPase subunit 152208005922092892Rat
2324835LOC100363054malate dehydrogenase 2, NAD (mitochondrial)58998218289984494Rat
6487214LOC100912356interferon alpha-1-like5103227820103230500Rat
6487307LOC100912373uncharacterized LOC10091237352833016728355691Rat
6487699LOC100912314interferon alpha-1-like5103285510103288640Rat
6489783LOC100911942zinc finger protein 37-like57504402175200228Rat
6486125LOC100912642cytochrome P450 2J3-like5110908195110930402Rat
6492384LOC100911527interferon alpha-12-like5103524733103525302Rat
6495230LOC10091102340S ribosomal protein S23-like52451555924516265Rat
6486737LOC100912510uncharacterized LOC10091251051719041417192458Rat
6487582Enhoenergy homeostasis associated55680098056802777Rat
6487777LOC100912327olfactory receptor 13C3-like56737248967373466Rat
6494360LOC100911221uncharacterized LOC1009112215109897523109949196Rat
6492721LOC100911464glutathione S-transferase P-like53858666738592201Rat
6490958LOC10091177140S ribosomal protein S6-like54031268240313404Rat
6494602LOC10091113440S ribosomal protein S15-like51245778012458197Rat
6491129LOC100911684ADP/ATP translocase 1-like58540968985410315Rat
6493177Agbl4AGBL carboxypeptidase 45125254963126534367Rat
6495515LOC100910962zinc finger protein 37-like57530189275311574Rat
6502160LOC100909766peptidyl-prolyl cis-trans isomerase D-like51852878218540240Rat
6495713LOC10091099440S ribosomal protein S18-like53514547535145950Rat
6499311LOC10091031540S ribosomal protein S12-like55832439458325731Rat
6499463LOC100910222ubiquitin-40S ribosomal protein S27a-like54891664348917100Rat
6502836LOC100909643interferon alpha-1-like5103273737103275988Rat
6500146LOC100910116transcription factor BTF3-like5122951278122951824Rat
6500251LOC100910132PRAME family member 12-like5116534373116537110Rat
6497336Palm2paralemmin 257231364672450645Rat
6500827LOC10091001760S ribosomal protein L31-like57598578575986272Rat
6497715LOC100910620uncharacterized LOC10091062057209458272101070Rat
6497739LOC100910621uncharacterized LOC1009106215123528822123554132Rat
6497914LOC100910535prefoldin subunit 6-like56071755360717974Rat
6497980LOC100910558uncharacterized LOC10091055859697618197014187Rat
6498132Ccdc180coiled-coil domain containing 18056015488360223508Rat
6498231LOC10091046160 kDa heat shock protein, mitochondrial-like5106398781106403426Rat
6498356LOC100910489kinectin-like5105565480105575498Rat
6501591LOC100909800guanine nucleotide-binding protein subunit beta-2-like 1-like51898710018990913Rat
7497822LOC102547167uncharacterized LOC1025471675121057292121078382Rat
7514994LOC102556219uncharacterized LOC1025562195113969322113977654Rat
7523626LOC102556461uncharacterized LOC10255646157272487472742702Rat
7525226LOC102547886placenta-expressed transcript 1 protein-like56847472768477394Rat
7526543LOC102551006uncharacterized LOC10255100652158814221628171Rat
7504318LOC102555886ribonuclease P protein subunit p38-like54744411947445294Rat
7506262LOC102551042uncharacterized LOC1025510425122296655122299913Rat
7529433LOC102551074uncharacterized LOC10255107457407691374089728Rat
7499527LOC102551410uncharacterized LOC10255141056802042068030171Rat
7530658LOC102549334uncharacterized LOC10254933454369784143757417Rat
7509921LOC102556039uncharacterized LOC10255603959528349895314373Rat
7502785LOC102553524uncharacterized LOC1025535245112230510112246625Rat
7513176LOC102553820uncharacterized LOC10255382053608558836089407Rat
7534874LOC102547534uncharacterized LOC10254753457591749175921199Rat
7516529LOC102551558exosome complex component RRP43-like56249637662498494Rat
7520008LOC102551110uncharacterized LOC10255111054661950146637446Rat
7540511LOC102550849uncharacterized LOC10255084957395654973963604Rat
7648089LOC102550175uncharacterized LOC1025501755120326955120333694Rat
7649691LOC102556095uncharacterized LOC10255609557210349272111379Rat
7651324LOC102555980uncharacterized LOC10255598054749277147502403Rat
7558064LOC102555405uncharacterized LOC10255540559296352893021460Rat
7559665LOC102552337PRAME family member 22-like5116613783116615014Rat
7637993LOC102552817uncharacterized LOC10255281751497160815016234Rat
7653207LOC102551372uncharacterized LOC10255137252174906421759653Rat
7638920LOC102552309uncharacterized LOC10255230952515280525154273Rat
7654450LOC102547236uncharacterized LOC1025472365119668167119673199Rat
7640679LOC102549899uncharacterized LOC10254989951943565319454889Rat
7641114LOC102556040noelin-like5113759457113762136Rat
7641478LOC10254923060S ribosomal protein L10a-like54973891149739989Rat
7657583LOC102549876uncharacterized LOC10254987654958355049587920Rat
7643335LOC102553326uncharacterized LOC10255332657084070370847771Rat
7629665LOC102555924uncharacterized LOC10255592452406921124077248Rat
7660377LOC102547623uncharacterized LOC1025476235101226928101245243Rat
7645046LOC102556374uncharacterized LOC1025563745114332364114334002Rat
7611658Fsbpfibrinogen silencer binding protein52505800325064283Rat
7555191LOC102551474uncharacterized LOC10255147456811484168145983Rat
7589034LOC102553455uncharacterized LOC10255345557141076071414956Rat
7592700LOC102554351uncharacterized LOC1025543515106358753106371776Rat
7593337LOC102550339uncharacterized LOC1025503395110107244110110709Rat
7618446LOC102549737uncharacterized LOC10254973751325044113272830Rat
7573312LOC102557269uncharacterized LOC10255726954979119149864621Rat
7543605LOC102546952uncharacterized LOC1025469525108270998108359486Rat
7556402LOC102548249uncharacterized LOC1025482495117352521117412598Rat
7573721Smim27small integral membrane protein 2755539869655400308Rat
7556989LOC102557253igE-binding protein-like53263950232645632Rat
7545693Podnpodocan5122774536122796755Rat
7561791LOC102548251uncharacterized LOC1025482515124800951124807191Rat
7548488LOC102551560uncharacterized LOC1025515605122474642122476368Rat
7550670LOC102550203zinc finger protein 120-like57309120573091526Rat
7604289LOC102549668uncharacterized LOC1025496685120006217120012535Rat
7604960LOC102547431uncharacterized LOC10254743152426982624283178Rat
7551556LOC102553821uncharacterized LOC10255382155667907056684701Rat
7585186LOC102552694zinc finger CCCH-type antiviral protein 1-like5122692573122699273Rat
7586726LOC102552692uncharacterized LOC10255269252567482125715582Rat
7694123LOC102551858uncharacterized LOC10255185859706604597072072Rat
7695413LOC102547858uncharacterized LOC10254785857680748576814704Rat
7706450LOC102551711uncharacterized LOC10255171156269760362753262Rat
7708268LOC102553889uncharacterized LOC10255388952806173828076577Rat
7708637LOC102546532uncharacterized LOC10254653257281555872823891Rat
7685874LOC102556038uncharacterized LOC10255603857205669372060103Rat
7711861LOC102549805uncharacterized LOC10254980551328171613326776Rat
7731407LOC102552377uncharacterized LOC10255237752527333925289529Rat
7712908LOC102546330uncharacterized LOC10254633056304368963061249Rat
7738149LOC10255467240S ribosomal protein S27-like5123216877123218666Rat
7697001LOC102554261high mobility group protein B1-like5106228556106229116Rat
7697358LOC102552523uncharacterized LOC1025525235104019105104127037Rat
7697789LOC102553131uncharacterized LOC10255313157700793877011175Rat
7743271LOC102552278uncharacterized LOC10255227859751279797520488Rat
7670634LOC102547621uncharacterized LOC10254762155695297756960366Rat
7670779LOC102552173protein DBF4 homolog A-like59742126497424352Rat
7746436LOC102555669uncharacterized LOC10255566959307964493197365Rat
7721743LOC102551073uncharacterized LOC10255107356148938761502617Rat
7747666LOC102546982alpha-enolase-like52453842024540101Rat
7747960Insl5insulin like 55117773104117777376Rat
7703644LOC102554881uncharacterized LOC10255488159236841092380389Rat
7729019LOC102552020uncharacterized LOC10255202052204894322052627Rat
7682781LOC102553640zinc finger protein 37-like57497845374985589Rat
9135524LOC103695239uncharacterized LOC10369523952455805624608755Rat
9097677LOC103692449uncharacterized protein-like5119140608119141297Rat
9106595LOC103692379small ubiquitin-related modifier 3 pseudogene58527277285273104Rat
9112029LOC10369243660S ribosomal protein L28-like5121868202121868751Rat
9196141LOC103692307protein SON-like51846947618473456Rat
9161289LOC103692433uncharacterized LOC1036924335120344175120357630Rat
9116417LOC103692302uncharacterized LOC10369230252467117324720087Rat
9120358LOC103692409non-histone chromosomal protein HMG-17-like59405577094062563Rat
9171422LOC103692447chromatin assembly factor 1 subunit A-like5116514762116515846Rat
9071259LOC103692399uncharacterized LOC10369239959925428299256197Rat
9082336LOC103692331uncharacterized LOC10369233154845049948520234Rat
9267319LOC103695253uncharacterized LOC10369525357514215675145524Rat
9225019LOC10369524660S ribosomal protein L39-like53864218238642839Rat
9272632LOC103692300uncharacterized LOC10369230052291604222921564Rat
9234855LOC103692377uncharacterized LOC10369237757750867977564182Rat
9323738LOC103695237uncharacterized LOC10369523751619288716195997Rat
9283972LOC103692326uncharacterized LOC10369232654599237845995040Rat
9284656LOC103692415uncharacterized LOC1036924155108723428108734153Rat
9246609LOC103692348uncharacterized LOC10369234855991124059915448Rat
9297465LOC103692338putative thymosin beta-4-like protein 655731945957319811Rat
9340681LOC103692353uncharacterized LOC10369235356784980867858913Rat
9302605LOC103692303uncharacterized LOC10369230352483066924855700Rat
9264036LOC103692427uncharacterized LOC1036924275117278306117329847Rat
9330186LOC10369234660S ribosomal protein L24 pseudogene55937347759374019Rat
9390410LOC103692428small EDRK-rich factor 2 pseudogene5117764116117764318Rat
9472653LOC103692301uncharacterized LOC10369230152480548324812407Rat
9434881LOC103692341gamma-glutamylaminecyclotransferase-like54734324847355132Rat
9435428LOC103692329eukaryotic initiation factor 4A-I pseudogene54775341147754665Rat
9404082LOC103692411uncharacterized LOC1036924115104410856104415793Rat
9444073LOC103692317histone deacetylase 1 pseudogene53406494734076063Rat
9408812LOC103692393uncharacterized LOC10369239359716511397170168Rat
9409380LOC103692392uncharacterized LOC10369239259677105896771421Rat
9452275LOC103692281BET1 homolog pseudogene51167072111671079Rat
9453420LOC103692336uncharacterized LOC10369233655680576556817066Rat
9455316LOC103690179phosphoglycerate mutase 1-like55959321759593995Rat
9417869LOC103692418uncharacterized LOC1036924185110605125110712729Rat
9685074Mir3084cmicroRNA 3084c58417737584177443Rat
9685089Lnc056long non-coding RNA 05652216267422163117Rat
11434367LOC108350932uncharacterized LOC10835093252410676124123754Rat
11464753LOC108351128uncharacterized LOC10835112857278598072792102Rat
11466141LOC108350963uncharacterized LOC10835096356086071560864473Rat
11472967LOC10835112160S ribosomal protein L29 pseudogene52753782727538390Rat
11473324LOC10835110240S ribosomal protein S20 pseudogene5101460139101460978Rat
11474955LOC108350993uncharacterized LOC10835099359847835098487366Rat
11475977Trnah-gug10transfer RNA histidine (anticodon GUG) 1059708722797087298Rat
11360528LOC108350948uncharacterized LOC10835094854769506447706817Rat
11444056LOC108350937ferritin light chain 1 pseudogene52843074328431569Rat
11457499LOC108351089heterogeneous nuclear ribonucleoprotein A1-like55365434253655308Rat
11436894LOC108350951uncharacterized LOC10835095154906192649094913Rat
11458786LOC108350991uncharacterized LOC10835099159566871795710953Rat
11365609LOC108350978uncharacterized LOC10835097857195962271960619Rat
11459931LOC108350995uncharacterized LOC1083509955102119628102128446Rat
11366942LOC10835108560S ribosomal protein L13 pseudogene53319174133201352Rat
11357613LOC108350962uncharacterized LOC10835096256088192860890626Rat
11371333LOC108350984U6 snRNA-associated Sm-like protein LSm6 pseudogene57714581477155846Rat
11449903LOC108350931uncharacterized LOC10835093152222723222235944Rat
11361552LOC108350985uncharacterized LOC10835098558255050182595277Rat
11439912LOC108350950uncharacterized LOC10835095054827279048371017Rat
11452394LOC108350953small ubiquitin-related modifier 2 pseudogene54948279049483777Rat
11453663LOC108350924uncharacterized LOC10835092451804101118060823Rat
11433168LOC108351130uncharacterized LOC10835113058546400885465546Rat
11383413LOC108351095serine/arginine repetitive matrix protein 1-like58544262085444118Rat
11383635LOC108351136uncharacterized LOC1083511365109866403109876222Rat
11405418LOC10835113240S ribosomal protein S29-like59776436997764539Rat
11413299LOC108350998uncharacterized LOC1083509985103757997103779881Rat
11413524LOC108351007uncharacterized LOC1083510075117271236117278283Rat
11413852LOC108351005uncharacterized LOC1083510055112797944112805529Rat
11415834LOC108350970uncharacterized LOC10835097056484877564970925Rat
11416818LOC108351001uncharacterized LOC1083510015106877052106903186Rat
11418076LOC108351000uncharacterized LOC1083510005106922423106936905Rat
11418089LOC108351004uncharacterized LOC1083510045109851042109866282Rat
11421297LOC108351104PRAME family member 12-like5116480878116483954Rat
11385100LOC108350923uncharacterized LOC10835092351430730214312194Rat
11374185LOC108350929uncharacterized LOC10835092952190195421930923Rat
11375408LOC108350928uncharacterized LOC10835092852157041721574912Rat
11398296LOC108350949uncharacterized LOC10835094954783364147845926Rat
11398785LOC10835112060S ribosomal protein L17 pseudogene52746049327461058Rat
11388087LOC108350944uncharacterized LOC10835094454631252546332473Rat
11410745LOC108351012uncharacterized LOC1083510125123999719124012690Rat
11389431LOC108350947uncharacterized LOC10835094754741423947422384Rat
11400923LOC108351093H/ACA ribonucleoprotein complex subunit 3 pseudogene57693498976936468Rat
11400924Trnas-aga1transfer RNA serine (anticodon AGA) 152399628823996369Rat
11380122LOC108351070small ubiquitin-related modifier 2 pseudogene5119732630119735272Rat
11381374LOC108350987COMM domain-containing protein 2 pseudogene58802717288030854Rat
11403548LOC108348231major urinary protein-like57546285575498898Rat
11381498LOC108351103ferritin light chain 1 pseudogene5111247525111248020Rat
11404702LOC108351088uncharacterized LOC10835108855421856054219234Rat
11476908LOC108350959uncharacterized LOC10835095955833701058350402Rat
11502494LOC108351096dnaJ homolog subfamily B member 1 pseudogene58768168087682686Rat
11503786LOC108351119ferritin light chain 1 pseudogene52414242024143026Rat
11480254LOC108351124uncharacterized LOC10835112454378010443783053Rat
11505979LOC108350952uncharacterized LOC10835095254906238049063472Rat
11499882LOC108350968uncharacterized LOC10835096856288035062910661Rat
11499899LOC10835110140S ribosomal protein S17 pseudogene59779048697794517Rat
11514913LOC108350981uncharacterized LOC10835098157567230775691604Rat
11517012LOC108351080endogenous retrovirus group K member 9 Pol protein-like51373648313737690Rat
11517987LOC10835108140S ribosomal protein S18 pseudogene52206558922074840Rat
11487297LOC108351094serine/arginine repetitive matrix protein 1-like58547618585477725Rat
11518618LOC108351129uncharacterized LOC10835112958218638382197382Rat
11492083LOC108350992uncharacterized LOC10835099259780677697812220Rat
41322042LOC120103086ferritin heavy chain-like59508626195087200Rat
41379561LOC120103247U7 small nuclear RNA59922995599230058Rat
41379665LOC120102936uncharacterized LOC1201029365116198317116217439Rat
41086853LOC120103368U4 spliceosomal RNA5124264229124264369Rat
41167909LOC120102926uncharacterized LOC1201029265110586644110592691Rat
41248950LOC120103343small nucleolar RNA SNORA1756865391268654044Rat
41281883LOC120102821uncharacterized LOC12010282152237056722384103Rat
41282557LOC120103300U2 spliceosomal RNA57384285573843025Rat
41322375LOC120102845uncharacterized LOC12010284553609136236095251Rat
41355203LOC120102838uncharacterized LOC12010283852966282929715416Rat
41356641LOC120102866uncharacterized LOC12010286656025729860267598Rat
41380328LOC120103148uncharacterized LOC12010314855939229559395154Rat
41380609LOC120103072zinc finger protein 37-like57548850175532807Rat
41140167LOC120103164interferon alpha-12-like5103509610103510260Rat
41168764LOC120103291small nucleolar RNA SNORA4859520289795203037Rat
41205132LOC120102883uncharacterized LOC12010288357210115572115231Rat
41250028LOC120103276small nucleolar RNA SNORA2/SNORA34 family5122726968122727103Rat
41277993NEWGENE_6576114transfer RNA threonine (anticodon AGU)52693417726934249Rat
41284048LOC120103366small nucleolar RNA U35118248246118248345Rat
41324050LOC120102828uncharacterized LOC12010282852430018124317387Rat
41324074LOC120102896uncharacterized LOC12010289657618489376187189Rat
41324317NEWGENE_40934091transfer RNA alanine (anticodon AGC)57473727474737355Rat
41357879LOC120103337small nucleolar RNA SNORA1758699225086992375Rat
41384122LOC120103054serine/arginine-rich splicing factor 3-like51873441318734925Rat
41114642LOC120103224U1 spliceosomal RNA52284666122846823Rat
41114922LOC120103328small nucleolar RNA SNORA1752751011927510246Rat
41141437LOC120102927uncharacterized LOC1201029275110790119110818856Rat
41169748LOC120103074uncharacterized LOC12010307458543843585440033Rat
41169774LOC120102947uncharacterized LOC1201029475121856050121859503Rat
41170419LOC120102912phosphoglycerate mutase 1-like59968598999686573Rat
41251418LOC120103186U6 spliceosomal RNA58035941580359521Rat
41279671LOC120103158interferon alpha-12-like5103378576103379147Rat
41325019LOC120103336small nucleolar RNA SNORA1758566586285665987Rat
41358010LOC12010291760S ribosomal protein L19-like5108333257108335787Rat
41358446LOC120102922uncharacterized LOC1201029225109999528110003332Rat
41358655LOC12010305760S ribosomal protein L6-like54259253142593424Rat
41142637LOC120103155uncharacterized LOC12010315559306583793073188Rat
41142696LOC120103375U4 spliceosomal RNA52160213121602278Rat
41171666LOC120103203U6 spliceosomal RNA5103109366103109474Rat
41172741LOC120102933uncharacterized LOC1201029335115914125115916368Rat
41206721LOC120103331small nucleolar RNA SNORA1757782081177820944Rat
41206741LOC120102863uncharacterized LOC12010286355921362759226603Rat
41253648LOC120103271small nucleolar RNA SNORA1552933447529334604Rat
41253762LOC120103313small nucleolar RNA SNORA1756854841868548540Rat
41286228LOC120102873uncharacterized LOC12010287356219883162234609Rat
41286760LOC120102893major urinary protein-like57557956475581856Rat
41327246LOC120103060uncharacterized LOC12010306055628697356300346Rat
41359748LOC120103345small nucleolar RNA SNORA1752095404020954161Rat
41360960LOC12010311960S ribosomal protein L9-like5123483635123484270Rat
41386911LOC120103361U2 spliceosomal RNA57030731870307431Rat
41091925LOC120103141heterogeneous nuclear ribonucleoprotein A3-like51143347611439810Rat
41092501LOC120102859putative 60S ribosomal protein L39-like 555731859057318749Rat
41092901LOC120102935uncharacterized LOC1201029355115975885115978833Rat
41145427LOC120103327small nucleolar RNA SNORA1758750390987504029Rat
41145702LOC120103235U1 spliceosomal RNA5110355813110355974Rat
41145764LOC120103388U6 spliceosomal RNA54068212540682231Rat
41173321LOC120102911histone H2A.Z-like57972162879721952Rat
41208256LOC120103326small nucleolar RNA SNORA1752940795329408081Rat
41209452NEWGENE_40933693transfer RNA proline (anticodon GGG)57558855575588628Rat
41209789LOC120103334small nucleolar RNA SNORA1752765310727653215Rat
41259190LOC12010287860S ribosomal protein L36a-like56795430567958398Rat
41260363LOC120102910uncharacterized LOC1201029105104171383104185974Rat
41361409LOC120103257U1 spliceosomal RNA5117340131117340290Rat
41361854LOC12010309160S ribosomal protein L9-like5115982278115982849Rat
41361886LOC120102877uncharacterized LOC12010287756719190567195516Rat
41362403LOC120102818eukaryotic translation elongation factor 1 epsilon-1-like51945564319457562Rat
41388173LOC120102831WD repeat and SOCS box-containing protein 1-like52488168824891528Rat
41388855LOC120103383U6 spliceosomal RNA5105346075105346181Rat
41174538LOC120102837tubulin alpha-1D chain-like52951187629518964Rat
41175373LOC120103115uncharacterized LOC1201031155112244680112248682Rat
41260485LOC120102944uncharacterized LOC1201029445121408508121412443Rat
41261574LOC120103353small nucleolar RNA SNORD7557448345274483511Rat
41329014LOC120103196U6 spliceosomal RNA56712440067124500Rat
41362570LOC120102887zinc finger protein 37-like57521304975221201Rat
41363728LOC120102865uncharacterized LOC12010286556021582360222294Rat
41389895LOC120103067tubulin alpha-1A chain-like55290789152911653Rat
41390808LOC120103319small nucleolar RNA SNORA1751684576216845890Rat
41095319LOC120103275small nucleolar RNA SNORA4458024866580248782Rat
41120437LOC120102815uncharacterized LOC12010281551673192316761548Rat
41149442LOC120102848uncharacterized LOC12010284854604083146066269Rat
41187183LOC120103157uncharacterized LOC12010315759910482899119859Rat
41188737LOC120102826uncharacterized LOC12010282652401469424029945Rat
41262738LOC120103208U6 spliceosomal RNA54304813943048245Rat
41330287LOC120103245U7 small nuclear RNA55508991255089976Rat
41330673LOC120102899uncharacterized LOC12010289958352735783609586Rat
41364653LOC120102941uncharacterized LOC1201029415120664956120672754Rat
41097131LOC120103161interferon alpha-12-like5103441204103442180Rat
41097146LOC120102907uncharacterized LOC1201029075103901281103925151Rat
41097241LOC120103318small nucleolar RNA SNORA175105738478105738609Rat
41121936LOC120102814uncharacterized LOC12010281451497213414983916Rat
41122038LOC120102869uncharacterized LOC12010286956090395160904907Rat
41190661NEWGENE_40938314transfer RNA serine (anticodon AGA)57467176274671843Rat
41212488LOC120103151uncharacterized LOC12010315156914468869153641Rat
41264577LOC120103306small nucleolar RNA SNORA175124306820124306946Rat
41367081LOC120103256small nucleolar RNA SNORD113/SNORD114 family56369844663698522Rat
41098563LOC120103053preferentially expressed antigen in melanoma-like protein 751183103711832415Rat
41122460LOC120102870uncharacterized LOC12010287056155012661567214Rat
41122531LOC120102880uncharacterized LOC12010288056949405369506142Rat
41123726LOC120103118HMG-Y-related protein A-like5123332484123354542Rat
41192036LOC120103344U2 spliceosomal RNA54842749848427636Rat
41215040LOC120102919uncharacterized LOC1201029195108831467108907138Rat
41367836LOC120102934uncharacterized LOC1201029345115963226115977411Rat
41394140LOC120103266small Cajal body-specific RNA 85101124125101124255Rat
41394229LOC120102921uncharacterized LOC1201029215109883550109887133Rat
41394701LOC120102847uncharacterized LOC12010284754485879044922780Rat
41394794LOC120103236U6 spliceosomal RNA5107652473107652571Rat
41395404LOC120103059uncharacterized LOC12010305951628400116429252Rat
41100894LOC120102832RNA-binding protein 12B-A-like52559050025597273Rat
41101046LOC120102830uncharacterized LOC12010283052486926424872255Rat
41124713LOC120103308small nucleolar RNA SNORA1756223163762231768Rat
41124986LOC120103374U4 spliceosomal RNA53356421533564342Rat
41155819LOC120103062uncharacterized LOC12010306257103473071037178Rat
41155933LOC120103302small nucleolar RNA SNORA1758857255288572680Rat
41193020LOC120103357small nucleolar RNA SNORD121A55636700956367089Rat
41193095LOC120103080uncharacterized LOC12010308058547212485473655Rat
41215575LOC120102929ubiquitin carboxyl-terminal hydrolase 15-like5113559958113563874Rat
41215818LOC120103303small nucleolar RNA SNORA1756943219369432324Rat
41344762LOC120103084developmentally-regulated GTP-binding protein 1-like59089386490972201Rat
41344927LOC120103149proteasome subunit beta type-3-like56213299462133594Rat
41369930LOC120103070zinc finger protein 37-like57486333974895596Rat
41102124LOC120102839importin subunit alpha-1-like53044913630455949Rat
41102148LOC120103204U6 spliceosomal RNA57704088277040985Rat
41157556LOC120103071major urinary protein-like57528152075283268Rat
41194781LOC120103371U4 spliceosomal RNA54974815649748295Rat
41194899LOC120103068SUMO-conjugating enzyme UBC9-like55567970855692106Rat
41217704LOC120103339small nucleolar RNA SNORA1756324864463248766Rat
41346487LOC120103168uncharacterized LOC1201031685116670973116707048Rat
41347757LOC120102819ras GTPase-activating protein-binding protein 1-like51973493319737218Rat
41371967LOC120103064uncharacterized LOC12010306459112235491641754Rat
41398222LOC120103116uncharacterized LOC1201031165118861720118905161Rat
41398365LOC120103349small nucleolar RNA SNORA405123218554123218681Rat
41069886LOC120103194U6 spliceosomal RNA54755397647554081Rat
41102833LOC120103292small nucleolar RNA SNORA4853517650435176637Rat
41127110LOC120103273small nucleolar RNA SNORA4458393538783935515Rat
41128100LOC120103150olfactory receptor 13C3-like56742361867424571Rat
41183840LOC120102906uncharacterized LOC1201029065102229484102238875Rat
40980304LOC120103169uncharacterized LOC1201031695119673292119674938Rat
41195959LOC120102834uncharacterized LOC12010283452716768927188550Rat
41270715LOC120103066putative E3 ubiquitin-protein ligase UBR754951026449512757Rat
41373051LOC120102855uncharacterized LOC12010285555536968155370818Rat
41373478LOC120103197U6 spliceosomal RNA5115097451115097553Rat
41071177LOC120103201U6 spliceosomal RNA58269977582699881Rat
41104723LOC120103225U6 spliceosomal RNA5123280963123281069Rat
41128577LOC120103082high mobility group protein B2-like58887382988874342Rat
41129082LOC120102903POU domain, class 4, transcription factor 1-like59787877297883186Rat
41162071LOC120103160interferon alpha-12-like5103426092103427016Rat
41185977LOC120102856uncharacterized LOC12010285655551486355520852Rat
41186256LOC120102900uncharacterized LOC12010290058396088483976651Rat
41186497LOC120102811uncharacterized LOC12010281151224979812254124Rat
41197324LOC120103332small nucleolar RNA SNORA1758675458386754709Rat
41197686LOC120103216U6 spliceosomal RNA5115066080115066186Rat
41229778LOC120103317small nucleolar RNA SNORA175103919376103919499Rat
41271580LOC120103296small nucleolar RNA SNORA1754935856049358689Rat
41350556LOC120103214U6 spliceosomal RNA52234882522348930Rat
41350661LOC120103254small nucleolar RNA SNORA705115961775115961902Rat
41374908Spaarsmall regulatory polypeptide of amino acid response55798556957991972Rat
41081239LOC120102827uncharacterized LOC12010282752403682024043057Rat
41162930LOC120103359small nucleolar RNA SNORD121A55635624356356319Rat
41162947LOC12010314540S ribosomal protein S20-like53880265738803367Rat
41198326LOC120103077uncharacterized LOC12010307758545591285457437Rat
41272850LOC120102857uncharacterized LOC12010285755694557756952969Rat
41272998LOC120103341small nucleolar RNA SNORA1756602623666026348Rat
41294123LOC120102854uncharacterized LOC12010285455214079152143955Rat
41294829LOC120103330small nucleolar RNA SNORA1754253603042536158Rat
41352216LOC120102849uncharacterized LOC12010284954659689946619460Rat
41402458LOC120102924uncharacterized LOC1201029245110208856110225659Rat
41107926LOC120103114uncharacterized LOC1201031145112416267112442856Rat
41108077LOC120102928uncharacterized LOC1201029285113530232113546618Rat
41108305LOC12010281360 kDa heat shock protein, mitochondrial-like51449799614499931Rat
41132309LOC120102885uncharacterized LOC12010288557456447374568006Rat
41164037LOC120103159interferon alpha-12-like5103407135103407884Rat
41164079LOC120102860uncharacterized LOC12010286055753872457568537Rat
41164090LOC12010308160S ribosomal protein L34-like58701752187020226Rat
41164745LOC120103360small nucleolar RNA U5451681994516820012Rat
41199365LOC120103230U6 spliceosomal RNA57930709979307205Rat
41296488LOC120102939uncharacterized LOC1201029395119887232119888833Rat
41352849LOC120103380U6 spliceosomal RNA55798503557985141Rat
41377042LOC120103354U6atac minor spliceosomal RNA56760131267601439Rat
41404093LOC120103153uncharacterized LOC12010315357349116173494563Rat
41084988LOC120102871uncharacterized LOC12010287156172824561741721Rat
41085030LOC120103085zinc finger CCHC domain-containing protein 9-like59239049992406353Rat
41108935LOC120103243U7 small nuclear RNA57448812374488181Rat
41133959LOC120103304small nucleolar RNA SNORA1753928202539282156Rat
41166424LOC120103363U2 spliceosomal RNA52849750128497630Rat
41200968LOC120102864uncharacterized LOC12010286455947188159475003Rat
40944816LOC120102913uncharacterized LOC1201029135106613937106645065Rat
40971150LOC120103321small nucleolar RNA SNORA1759583074095830865Rat
40998077LOC120102943uncharacterized LOC1201029435121360322121364747Rat
40998207LOC120102898uncharacterized LOC12010289858261444582621071Rat
40946078LOC120103154uncharacterized LOC12010315457816128078184113Rat
40972487NEWGENE_40940579transfer RNA leucine (anticodon AAG)56986995869870038Rat
40972884LOC120102833uncharacterized LOC12010283352646198526467263Rat
40972972LOC120102902protein PRRC2C-like59555314795562018Rat
40948141LOC120103234U6 spliceosomal RNA57250483872504938Rat
40974238LOC120103188U6 spliceosomal RNA59841452898414634Rat
41016107LOC120103348small nucleolar RNA SNORA1759748166497481780Rat
40974341LOC120103228U6 spliceosomal RNA51026308710263191Rat
41340414LOC120103217U6 spliceosomal RNA5115816834115816936Rat
41340812LOC120103315small nucleolar RNA SNORA1755864448858644614Rat
40975974LOC120103162interferon alpha-1-like5103455380103455934Rat
40976711LOC120102817uncharacterized LOC12010281751808972818103756Rat
40976841NEWGENE_40933816transfer RNA valine (anticodon AAC)54908089349080965Rat
41012570LOC120103241U7 small nuclear RNA5111397995111398057Rat
41013620LOC120103083conserved oligomeric Golgi complex subunit 5-like59064539790816683Rat
40926645LOC120103314small nucleolar RNA SNORA1756688363866883766Rat
40927816LOC120103142uncharacterized LOC12010314252423019924231625Rat
40956040LOC120103055protein BEX4-like52862147428684995Rat
40980160LOC120102881uncharacterized LOC12010288157009059670103137Rat
40980997LOC120102858uncharacterized LOC12010285855740698657422319Rat
40999109LOC120102891major urinary protein-like57539412375397484Rat
40929618LOC120102923uncharacterized LOC1201029235110179996110186201Rat
40929885LOC12010306340S ribosomal protein SA-like57112474671125687Rat
40957686LOC120102904ladinin-1-like59825993498274752Rat
40981943LOC12010293060S ribosomal protein L15-like5113792289113793252Rat
40982088LOC120103090cytochrome P450 2J2-like5111007780111057797Rat
41001063LOC120103384U6 spliceosomal RNA51537542215375528Rat
41002171NEWGENE_40934091transfer RNA alanine (anticodon AGC)56368361763683691Rat
40958085LOC120102950uncharacterized LOC1201029505124196081124203291Rat
40932422LOC120102872uncharacterized LOC12010287256195026661963787Rat
40933017LOC120103152cytochrome c oxidase subunit 6B1-like56964624769646803Rat
40960952LOC120102882uncharacterized LOC12010288257046003770477599Rat
40985493LOC120103329small nucleolar RNA SNORA1753599237635992505Rat
40985797NEWGENE_40934091transfer RNA alanine (anticodon AGC)5121943838121943912Rat
41006368LOC120103311U2 spliceosomal RNA54123388541233967Rat
41007842LOC120103346small nucleolar RNA SNORA1755737819257378303Rat
40937057LOC120103250U7 small nuclear RNA5122542313122542380Rat
40937684LOC120102920uncharacterized LOC1201029205109330329109338769Rat
40938154LOC120102824uncharacterized LOC12010282452301332023022049Rat
40962879LOC12010306940S ribosomal protein S18-like57028434770316393Rat
40987917LOC120102894uncharacterized LOC12010289457597160175972858Rat
41008049LOC120102812uncharacterized LOC12010281251332942413361574Rat
40939148LOC120103320small nucleolar RNA SNORA1751883011718830241Rat
40988753LOC120103293small nucleolar RNA SNORA485120966305120966422Rat
40989424LOC120103252small nucleolar RNA SNORA705109807447109807582Rat
41009651LOC120103073uncharacterized LOC12010307357565420575664531Rat
40940830LOC120103220U6 spliceosomal RNA55618933456189452Rat
40965561LOC120103061uncharacterized LOC12010306155648534456491627Rat
40966355LOC120103290small nucleolar RNA SNORA485111718328111718474Rat
40992078LOC120102874uncharacterized LOC12010287456223105162234747Rat
40941923LOC120102836uncharacterized LOC12010283652871884128768110Rat
40993322LOC120102909uncharacterized LOC1201029095104003107104016993Rat
40994216LOC120102890major urinary protein-like57542016175422438Rat
40994510LOC120102938metallothionein-2-like5119728976119732537Rat
40944019LOC120103219U6 spliceosomal RNA53105101031051115Rat
40944481LOC120103076uncharacterized LOC12010307658545186285453391Rat
40969773LOC120103351small nucleolar RNA SNORA2653828552538285644Rat
40970507LOC120102945uncharacterized LOC1201029455121621354121625108Rat
41046326LOC120103295small nucleolar RNA SNORA1751981437419814505Rat
41046330LOC120103278small nucleolar RNA SNORA95112966475112966607Rat
41074835LOC120103248U7 small nuclear RNA53878275638782820Rat
41074883Tusc1tumor suppressor candidate 15108089952108091636Rat
41243557LOC120103056wee1-like protein kinase 253555171635553140Rat
41311458LOC120102949elongin-C-like5124125937124127436Rat
41311684LOC120102948uncharacterized LOC1201029485122301858122302471Rat
41024711LOC120103163interferon alpha-12-like5103494442103495077Rat
41075750LOC120103316small nucleolar RNA SNORA1753460649634606629Rat
41075768LOC120102897uncharacterized LOC12010289758263378382636269Rat
41076057LOC120103294small nucleolar RNA SNORA1754810633948106470Rat
41076485LOC120102886uncharacterized LOC12010288657451184374515127Rat
41312846LOC120103244U7 small nuclear RNA53215196932152031Rat
41313046LOC120103226U6 spliceosomal RNA54858804548588141Rat
41025292LOC120102908SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1-like57218614672200555Rat
41025543LOC120103209U6 spliceosomal RNA59060509090605193Rat
41025698LOC120102932uncharacterized LOC1201029325115683207115693880Rat
41025792LOC120102816uncharacterized LOC12010281651769069117736386Rat
41077767LOC120103251small nucleolar RNA SNORD7351869202518692080Rat
41078263LOC120103367small nucleolar RNA U354937190549372024Rat
41078950LOC120103223U6 spliceosomal RNA5122805182122805288Rat
41245849LOC120103242U7 small nuclear RNA5111531726111531787Rat
41246143LOC120103221U6 spliceosomal RNA55554495855545064Rat
41316018LOC120103215U6 spliceosomal RNA55046074850460853Rat
41316176LOC120103312small nucleolar RNA SNORA175102483194102483318Rat
41316576LOC120103249U7 small nuclear RNA5111531651111531712Rat
41028138LOC120103269small nucleolar RNA SNORA557113206671132150Rat
41052311LOC120102876eukaryotic translation initiation factor 2 subunit 1-like56403946064051932Rat
41134400LOC120103170uncharacterized LOC1201031705120785823120801032Rat
41247414LOC120102937uncharacterized LOC1201029375119526679119538134Rat
41319702LOC120103075uncharacterized LOC12010307558544663085448161Rat
41029367LOC12010308760S ribosomal protein L27a-like5103328721103329166Rat
41030381LOC120102868uncharacterized LOC12010286856069396560699404Rat
41030934LOC12010311760S ribosomal protein L9-like5123193865123195154Rat
41052978LOC120103297small nucleolar RNA SNORA1751773591417736044Rat
41134945LOC120102842uncharacterized LOC12010284253526381335266767Rat
41248460LOC120102853uncharacterized LOC12010285354837353548403687Rat
41255465LOC120102895uncharacterized LOC12010289557616671976167330Rat
41255483LOC120103088peptidyl-prolyl cis-trans isomerase A-like5105600882105603060Rat
41332442LOC120103156uncharacterized LOC12010315659638721896389315Rat
41136247LOC12010291560S ribosomal protein L5-like5107212048107217257Rat
41143086LOC120103387U6 spliceosomal RNA5106129987106130093Rat
41256844LOC120102846uncharacterized LOC12010284654308424543103773Rat
41055096LOC120102823uncharacterized LOC12010282352269711922704317Rat
41055101LOC120102905uncharacterized LOC1201029055101831467101846644Rat
41144673LOC120102862uncharacterized LOC12010286255889677158899409Rat
41144701LOC120102901uncharacterized LOC12010290158759930187602345Rat
41151486LOC120103355U2 spliceosomal RNA54409051344090680Rat
41257904LOC120103382U6 spliceosomal RNA55460119254601298Rat
41335677LOC120103222U6 spliceosomal RNA53903012139030224Rat
41336381LOC120102879uncharacterized LOC12010287956802166368030631Rat
41317448LOC120103335small nucleolar RNA SNORA1753887785038877982Rat
41032391NEWGENE_40926764transfer RNA proline (anticodon AGG)53214375232143824Rat
41222336LOC120102840partner of Y14 and mago-like53314213433146238Rat
41222521LOC120103120uncharacterized LOC1201031205123927866123939165Rat
41222628LOC120102844uncharacterized LOC12010284453583956535843140Rat
41314783LOC120102829hsc70-interacting protein-like52468005024684165Rat
41034517LOC120103165GSK3B-interacting protein-like5103941903103943310Rat
41224678LOC120103289U2 spliceosomal RNA5120473916120474106Rat
41225041LOC120102888major urinary protein-like57546285575472666Rat
41337561LOC120103121uncharacterized LOC1201031215123891920123896857Rat
41035118LOC120103058uncharacterized LOC12010305851601108516015518Rat
41225436LOC120102889major urinary protein-like57491752475569763Rat
41225607LOC120102892major urinary protein-like57501439375016663Rat
41226688LOC120102835uncharacterized LOC12010283552755964727586169Rat
41301366LOC120102867uncharacterized LOC12010286756029682160318015Rat
41301908LOC120103143chromatin target of PRMT1 protein-like52491451624919438Rat
41302148LOC120103147uncharacterized LOC12010314755865494358659293Rat
41302224LOC120102850uncharacterized LOC12010285054693292946937124Rat
41334530LOC120102946uncharacterized LOC1201029465121688135121689649Rat
41334998LOC120102884NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5-like57365922373659587Rat
41038197LOC120103299small nucleolar RNA SNORA1757020966370209794Rat
41038477LOC120103270small nucleolar RNA SNORA851321464613214785Rat
41063004LOC120102825uncharacterized LOC12010282552402767024031806Rat
41227498LOC120103358small nucleolar RNA SNORD121A55636927856369356Rat
41235371LOC12010308960S ribosomal protein L8-like5109207408109230540Rat
41302851LOC120103238U6 spliceosomal RNA5123754011123754111Rat
41303713LOC120103338small nucleolar RNA SNORA1756469761764697721Rat
41016461LOC120102852uncharacterized LOC12010285254746852847472049Rat
41305661LOC120102841uncharacterized LOC12010284153514989835192551Rat
41040765LOC120102820uncharacterized LOC12010282052224295322247572Rat
41041337LOC120102875uncharacterized LOC12010287556308423563097575Rat
41237335LOC120103146uncharacterized LOC12010314654643085646432860Rat
41238411LOC120103078uncharacterized LOC12010307858545995885461489Rat
41307010LOC120103144uncharacterized LOC12010314452903259729047722Rat
41020171LOC120102822uncharacterized LOC12010282252265484222679142Rat
41020351LOC120103356U6atac minor spliceosomal RNA52500862725008726Rat
41044339LOC120102851uncharacterized LOC12010285154699298847009537Rat
41069231LOC120103166uncharacterized LOC1201031665106108110106109796Rat
41308087LOC120102940uncharacterized LOC1201029405119967274119994416Rat
41020726LOC120103079uncharacterized LOC12010307958546807885469609Rat
41021982LOC12010284360S ribosomal protein L30-like53538183235382175Rat
41044958LOC120103373U4 spliceosomal RNA59625456696254697Rat
41074433LOC120103372U4 spliceosomal RNA5103532146103532302Rat
41241770LOC120102925uncharacterized LOC1201029255110819794110824522Rat
41309747LOC120103065uncharacterized LOC12010306559097382590991561Rat
41309963LOC120103301small nucleolar RNA SNORA1757030955770309688Rat
41023182LOC120103265small nucleolar RNA SNORA6857437920274379330Rat
41023677LOC120103113uncharacterized LOC1201031135112492479112512005Rat
3295Rhox5Rhox homeobox family member 5X116536207116541972Rat
61955Prps1phosphoribosyl pyrophosphate synthetase 1X104132139104154191Rat
2848Htr2c5-hydroxytryptamine receptor 2CX110640777110870288Rat
3354Plp1proteolipid protein 1X100184039100201035Rat
70890Pgrmc1progesterone receptor membrane component 1X115832865115841060Rat
2826Hprt1hypoxanthine phosphoribosyltransferase 1X132736175132768149Rat
3148Bex3brain expressed X-linked 3X9927323899274799Rat
69401Acsl4acyl-CoA synthetase long-chain family member 4X105942794106006573Rat
3593Rpl39ribosomal protein L39X116327183116330211Rat
70958Gria3glutamate ionotropic receptor AMPA type subunit 3X120238515120504106Rat
631402Igsf1immunoglobulin superfamily, member 1X129069891129085331Rat
727927Lhfpl1LHFPL tetraspan subfamily member 1X108815596108873460Rat
621277Xpnpep2X-prolyl aminopeptidase 2X127287765127317036Rat
621343Gprasp1G protein-coupled receptor associated sorting protein 1X9876558198772685Rat
708510Akap14A-kinase anchoring protein 14X116395512116410697Rat
620692XiapX-linked inhibitor of apoptosisX120890537120938413Rat
621801Timm8a1translocase of inner mitochondrial membrane 8A1X9771793297721918Rat
727808Gpr119G protein-coupled receptor 119X127852145127858198Rat
620990Nap1l3nucleosome assembly protein 1-like 3X8834759588350393Rat
708418Cd40lgCD40 ligandX135127119135138302Rat
621654Tsc22d3TSC22 domain family, member 3X104217898104277935Rat
2990Lamp2lysosomal-associated membrane protein 2X117173097117222090Rat
2340ChmCHM Rab escort proteinX7820320078361996Rat
628741Il13ra1interleukin 13 receptor subunit alpha 1X115348860115408682Rat
620994Atp1b4ATPase Na+/K+ transporting family member beta 4X117087284117108023Rat
727965Wdr44WD repeat domain 44X114481890114587307Rat
619833Serpina7serpin family A member 7X102663242102722319Rat
620439Gucy2fguanylate cyclase 2FX105710356105808183Rat
621433Slc25a14solute carrier family 25 member 14X127807630127845823Rat
1303224Bhlhb9basic helix-loop-helix family member B9X9882028998854949Rat
621750Drp2dystrophin related protein 2X9760757797658115Rat
2072Agtr2angiotensin II receptor, type 2X112119673112124060Rat
628645Brs3bombesin receptor subtype 3X134906817134932321Rat
619787Trpc5transient receptor potential cation channel, subfamily C, member 5X107946163108230978Rat
735215Chrdl1chordin-like 1X106889125106992937Rat
620598Nox1NADPH oxidase 1X9727905897332291Rat
708373Tmsb15b2thymosin beta 15B2X100298705100300820Rat
620817Aifm1apoptosis inducing factor, mitochondria associated 1X127650223127689356Rat
2615Fhl1four and a half LIM domains 1X134555399134614930Rat
2631Cenpicentromere protein IX9751591997567671Rat
620350Psmd10proteasome 26S subunit, non-ATPase 10X104656809104665126Rat
620838Il13ra2interleukin 13 receptor subunit alpha 2X111002590111074053Rat
620670DcxdoublecortinX107430767107573612Rat
620204Sytl4synaptotagmin-like 4X9713550097185867Rat
70960Capn6calpain 6X107380774107405489Rat
620938TnmdtenomodulinX9705713797072634Rat
3251Pak3p21 (RAC1) activated kinase 3X107116308107374342Rat
61947Pou3f4POU class 3 homeobox 4X7585864675859923Rat
620353Slc25a5solute carrier family 25 member 5X116031896116034963Rat
1305365Tesltestis derived transcript-likeX114680227114693795Rat
2725Gpc3glypican 3X131868983132236837Rat
621409Pls3plastin 3X111589193111683908Rat
1306640Rpl36aribosomal protein L36aX9776617997768892Rat
727788Tmem255atransmembrane protein 255AX116970793117035008Rat
1333338Olr1752-psolfactory receptor pseudogene 1752X110437444110437620Rat
1332660Olr1764-psolfactory receptor pseudogene 1764X128992854128993813Rat
1332669Olr1766olfactory receptor 1766X129169388129170320Rat
1560456Ct55cancer/testis antigen 55X133502545133515730Rat
1549784Hnrnph2heterogeneous nuclear ribonucleoprotein H2X9778089097786846Rat
1559646Klhl13kelch-like family member 13X113942309114107355Rat
620672AplnapelinX127180801127213567Rat
1333608Olr1751olfactory receptor 1751X129757182129758120Rat
1305249Snrpelsmall nuclear ribonucleoprotein E-likeX133163150133163576Rat
1359674Arhgef6Rac/Cdc42 guanine nucleotide exchange factor 6X135145447135264636Rat
1359683BtkBruton tyrosine kinaseX9772279697762315Rat
1563777Plac1placenta enriched 1X132821347132955143Rat
1563789Rhox12Rhox homeobox family member 12X116890562116897981Rat
1562485RGD1562485similar to RIKEN cDNA 4921511C20 geneX8957366189583547Rat
1562281RGD1562281similar to Eukaryotic translation initiation factor 5 (eIF-5)X113216161113217667Rat
1561826Tgif2lx2TGFB-induced factor homeobox 2-like, X-linked 2X8410920384110264Rat
1561445RGD1561445similar to novel proteinX115675412115725950Rat
1562864Pcdh11xprotocadherin 11 X-linkedX8605834886751078Rat
1561901MGC114492similar to melanoma antigen family A, 5X131542773131546613Rat
1563975Tex13cTEX13 family member CX122469125122471627Rat
1561389Zdhhc9zinc finger DHHC-type palmitoyltransferase 9X127352340127388245Rat
1563270RGD1563270similar to synaptonemal complex protein 3X133857772133871791Rat
1564196Gpr101G protein-coupled receptor 101X135540042135543958Rat
1563150RGD1563150similar to B-cell translocation gene 1X116749728116754643Rat
1562057Frmd7FERM domain containing 7X130375925130423836Rat
1359631Tceal8transcription elongation factor A like 8X9917130799173377Rat
1563753Frmpd3FERM and PDZ domain containing 3X103964168104113864Rat
1561004Ammecr1AMMECR nuclear protein 1X106465982106571382Rat
1564749Bex4brain expressed, X-linked 4X9913207699133413Rat
1561761Il1rapl2interleukin 1 receptor accessory protein-like 2X100961509102271753Rat
1561958RGD1561958similar to RIKEN cDNA 2010106E10X7753333977597166Rat
1561558RGD1561558similar to RIKEN cDNA 1700001F22X134184390134185772Rat
1561810Slc6a14solute carrier family 6 member 14X112314643112375412Rat
1564167RGD1564167similar to basic transcription factor 3X136385147136385621Rat
1565967Arhgap36Rho GTPase activating protein 36X128780148128787169Rat
1562951Rab9bRAB9B, member RAS oncogene familyX100220897100231591Rat
1561678Tenm1teneurin transmembrane protein 1X121400466122289877Rat
1563582Slc9a6solute carrier family 9 member A6X134430588134486747Rat
1562444Srpx2sushi-repeat-containing protein, X-linked 2X9710645597132197Rat
1561318RGD1561318similar to SET domain-containing proteinX9217834492180517Rat
1561687Dach2dachshund family transcription factor 2X7871896379018023Rat
1562219Rbm31yRNA binding motif 31, Y-linkedX9090429690906353Rat
1563295RGD1563295similar to RIKEN cDNA 2310036O22X108794365108795038Rat
1559928Slc25a43solute carrier family 25, member 43X115977437116011789Rat
1311230C1galt1c1C1GALT1-specific chaperone 1X117378123117382620Rat
1566108Bcorl1BCL6 co-repressor-like 1X127516504127584529Rat
1562947Arl13aADP ribosylation factor like GTPase 13AX9738037097406704Rat
1563104RGD1563104similar to Vigilin (High density lipoprotein-binding protein)X8962870589650241Rat
1564038Vgll1vestigial-like family member 1X134979657134996007Rat
1563873Dcaf12l1DDB1 and CUL4 associated factor 12-like 1X123695286123698905Rat
1566035RGD1566035similar to protein tyrosine phosphatase 4a1X116789584116790544Rat
1563189Rhox7Rhox homeobox family member 7X116627645116635721Rat
1560129Pabir2PABIR family member 2X132989124133015625Rat
1564353Nup62clnucleoporin 62 C-terminal likeX103668458103724957Rat
1560204Nxt2nuclear transport factor 2-like export factor 2X105855616105862902Rat
1359693Rnf113a1ring finger protein 113A1X116428037116429164Rat
1565674Mid2midline 2X104354692104456757Rat
1561307Pramelpreferentially expressed antigen in melanoma-likeX9845119998486998Rat
1562408Sh2d1aSH2 domain containing 1AX121373693121401923Rat
1561151RGD1561151similar to hypothetical protein 4932411N23X8973771589781873Rat
1563242RGD1563242similar to riboflavin kinaseX7345711773458446Rat
1561582RGD1561582similar to Fus1 proteinX7994528779946890Rat
1561055Ftl1l1ferritin light chain 1-like 1X131765928131766849Rat
1561666H2ab3H2A.B variant histone 3X8236263382362983Rat
1564446LOC501618LRRGT00179X9779125597796754Rat
1563291Rhox10reproductive homeobox 10X116850460116854898Rat
1562442Irs4insulin receptor substrate 4X105344016105359985Rat
1560798Pof1bPOF1B, actin binding proteinX7768312877749827Rat
1562768Zfp711zinc finger protein 711X7764630077679398Rat
1564466Bex2brain expressed X-linked 2X9901984799021375Rat
1561046Smarca1SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1X126980201127066385Rat
1561047Rhox8reproductive homeobox 8X116584742116588365Rat
1359486Mospd1motile sperm domain containing 1X133100200133127960Rat
1563084Tbc1d8bTBC1 domain family member 8BX103319181103407137Rat
1563086Sowahdsosondowah ankyrin repeat domain family member DX116292030116293660Rat
1564103Glra4glycine receptor, alpha 4X100110517100131042Rat
1564866RGD1564866similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein)X107752105107759183Rat
1566008RGD1566008similar to RIKEN cDNA 1700001F22X135622322135623034Rat
1303093Tmem35atransmembrane protein 35AX9750335097514198Rat
1562693Rbmx2RNA binding motif protein, X-linked 2X127888514127896239Rat
1559460RGD1559460similar to hypothetical protein 4932411N23X8950231289511983Rat
1562871RGD1562871similar to BMI1-like proteinX7350649573507638Rat
1564845RGD1564845similar to Xlr-likeX133561127133574507Rat
1561019Gprasp2G protein-coupled receptor associated sorting protein 2X9881766998823814Rat
1560817Rps6ka6ribosomal protein S6 kinase A6X7635482476454484Rat
1359416Alg13ALG13, UDP-N-acetylglucosaminyltransferase subunitX107885039107906264Rat
1334134Olr1753-psolfactory receptor pseudogene 1753X8015641080156966Rat
1359303Armcx6armadillo repeat containing, X-linked 6X9792903297932032Rat
1560264Upf3bUPF3B, regulator of nonsense mediated mRNA decayX116335308116353332Rat
1549739Armcx3armadillo repeat containing, X-linked 3X9793711597942098Rat
1559581Zfp36l3zinc finger protein 36, C3H type-like 3X133550348133553677Rat
1564027AmotangiomotinX108982399109041265Rat
1559530Nxf2nuclear RNA export factor 2X9813595398157117Rat
1359223XkrxXK related, X-linkedX9734115897353175Rat
1549724Tceal1transcription elongation factor A like 1X100058485100060439Rat
1549725Apoolapolipoprotein O-likeX7737768577443670Rat
1334403Olr1765olfactory receptor 1765X129014048129014986Rat
1562039RGD1562039similar to MGC82337 proteinX7429287574307793Rat
1562042Stag2stromal antigen 2X120974687121105677Rat
1564057Adgrg4adhesion G protein-coupled receptor G4X134734610134864449Rat
1560743Elf4E74 like ETS transcription factor 4X127587401127639063Rat
1359534Ube2aubiquitin-conjugating enzyme E2AX116114339116125076Rat
1564707Dock11dedicator of cytokinesis 11X115131720115314854Rat
1560119RGD1560119similar to actin alpha 1 skeletal muscle proteinX121159206121162455Rat
1560124RGD1560124similar to ribosomal protein L10aX117620592117621326Rat
1334384Olr1767olfactory receptor 1767X129289761129290684Rat
1563844Rhox9reproductive homeobox 9X116641863116644714Rat
1564898Taf7lTATA-box binding protein associated factor 7-likeX9766022297675241Rat
1560160Tspan6tetraspanin 6X9709239497099659Rat
1560768Dcaf12l2DDB1 and CUL4 associated factor 12-like 2X123293761123296550Rat
1359559Actrt1actin-related protein T1X125584102125585455Rat
1559445Brwd3bromodomain and WD repeat domain containing 3X7376834373861643Rat
1561860RGD1561860similar to Mitochondrial processing peptidase beta subunit, mitochondrial precursor (Beta-MPP; P-52)X100574877100579240Rat
1359439Zcchc12zinc finger CCHC-type containing 12X115433444115436691Rat
1585082Septin6septin 6X116153255116230334Rat
1563643Enox2ecto-NOX disulfide-thiol exchanger 2X128270941128593074Rat
1584423LOC684932similar to Zinc finger protein 75X134035116134053765Rat
1584982LOC302786similar to Heat shock protein HSP 90-beta (HSP 84)X8247510982477258Rat
1586045LOC367694similar to Fumarate hydratase, mitochondrial precursor (Fumarase)X118692571118694745Rat
1565430RGD1565430similar to RIKEN cDNA 1700001F22X126731780126732483Rat
1585073LOC691344similar to Breast carcinoma amplified sequence 2 homolog (DNA amplified in mammary carcinoma 1 protein)X116026387116027059Rat
1565441Klhl4kelch-like family member 4X7942919379719482Rat
1566390Mcts1MCTS1, re-initiation and release factorX117350723117362504Rat
1565344Zmat1zinc finger, matrin-type 1X9816838898199415Rat
1584679LOC681065hypothetical protein LOC681065X106745679106746330Rat
1566355RGD1566355similar to cell division cycle 2-like 1X107573678107590244Rat
1566363Akap17bA kinase (PRKA) anchor protein 17BX115843263115881597Rat
1565932Satl1spermidine/spermine N1-acetyl transferase-like 1X7745335777469100Rat
1359313Utp14aUTP14A small subunit processome componentX127439282127464634Rat
1560293Sash3SAM and SH3 domain containing 3X127326815127341521Rat
1560105RGD1560105similar to 40S ribosomal protein S19X107697983107698439Rat
1566136RGD1566136similar to 40S ribosomal protein S9X105572159105572766Rat
1563286Tmem164transmembrane protein 164X106288019106448642Rat
1587640LOC688539similar to Fructose-bisphosphate aldolase A (Muscle-type aldolase)X9515543295156523Rat
1583846LOC302814similar to glycogen synthase 1, muscleX127918793127920680Rat
1583847LOC302804hypothetical LOC302804X126904676126906513Rat
1586436LOC688664similar to Heat shock protein HSP 90-beta (HSP 84) (Tumor-specific transplantation 84 kDa antigen) (TSTA)X9670810696710139Rat
1583851LOC300277similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)X105466456105467608Rat
1564494Cul4bcullin 4BX117287481117326688Rat
1566387RGD1566387similar to hypothetical proteinX114972836115005286Rat
1563524Hspd1-ps21heat shock protein 1, pseudogene 21X125679740125680618Rat
1563536MGC109340similar to Microsomal signal peptidase 23 kDa subunit (SPase 22 kDa subunit) (SPC22/23)X9895053098952049Rat
1564923Nxf3nuclear RNA export factor 3X9902590199050409Rat
1587436LOC691151similar to 40S ribosomal protein S2X120749512120753948Rat
1562504Tceal3transcription elongation factor A like 3X100010675100012637Rat
1565032RGD1565032similar to transcription elongation factor B (SIII), polypeptide 2X115936938115937292Rat
1584368LOC684992similar to tropomyosin 3, gamma isoform 2X7618523376189109Rat
1583501Kcne5potassium voltage-gated channel subfamily E regulatory subunit 5X105930398105931013Rat
1561629Armcx1armadillo repeat containing, X-linked 1X9789896997902874Rat
1583914LOC691459similar to protein phosphatase 1, catalytic subunit, gamma isoformX112812252112814475Rat
1560520Sh3bgrlSH3 domain binding glutamate-rich protein likeX7416702974263783Rat
1564480RGD1564480similar to polyamine oxidase isoform 2X9801435598016514Rat
1566225RGD1566225similar to RIKEN cDNA 1700001F22X129470473129471169Rat
1565955NkapNFKB activating proteinX116373031116392677Rat
1566309Zbtb33zinc finger and BTB domain containing 33X116963337116970547Rat
1566312Dnaaf6dynein axonemal assembly factor 6X103724419103775633Rat
1560247Cldn2claudin 2X103459870103473794Rat
1564595Pramel3preferentially expressed antigen in melanoma-like 3X9841136998423713Rat
1566170Nxf7nuclear RNA export factor 7X9853537498552562Rat
1564669Zfp280czinc finger protein 280CX127716403127807600Rat
1563280Rab33aRAB33A, member RAS oncogene familyX127694219127706378Rat
1565570Vsig1V-set and immunoglobulin domain containing 1X104607031104640128Rat
1561623Thoc2THO complex 2X120634966120749569Rat
1563377Htatsf1HIV-1 Tat specific factor 1X134935426134949607Rat
1564399Diaph2diaphanous-related formin 2X9239518993234521Rat
1566339Mmgt1membrane magnesium transporter 1X134408463134420798Rat
1560927RGD1560927RGD1560927X116441825116444647Rat
1565514Map7d3MAP7 domain containing 3X134619227134647525Rat
1565834Mbnl3muscleblind-like splicing regulator 3X130641942130737179Rat
1359471Morf4l2mortality factor 4 like 2X100082562100093658Rat
1359132Armcx2armadillo repeat containing, X-linked 2X9798066297985523Rat
1561261Zic3Zic family member 3X136123662136134295Rat
1560955Ndufa1NADH:ubiquinone oxidoreductase subunit A1X116424223116427875Rat
1566129RGD1566129similar to Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)X124880957124888417Rat
1566282Rnf128ring finger protein 128X103183643103298431Rat
1563568Stk26serine/threonine kinase 26X130310855130375677Rat
1584897LOC367757similar to eukaryotic translation initiation factor 4BX109595488109597454Rat
1584898Luzp4leucine zipper protein 4X111280490111321363Rat
1584899LOC367750similar to RIKEN cDNA 1110007M04X111888462111890563Rat
1565256RbmxRNA binding motif protein, X-linkedX135305237135314806Rat
1565148Pwwp3bPWWP domain containing 3BX102804416102838580Rat
1565499Col4a5collagen type IV alpha 5 chainX105118762105322699Rat
1584907LOC367705similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)X113416013113418436Rat
1565392Pcdh19protocadherin 19X9676768696873477Rat
1563443Usp26ubiquitin specific peptidase 26X131317200131363964Rat
1563666Hdxhighly divergent homeoboxX7655253976869972Rat
1564332Rhox11Rhox homeobox family member 11X116871847116880098Rat
1584677LOC681067similar to RIKEN cDNA 1700001F22X124788553124789270Rat
1559905Morc4MORC family CW-type zinc finger 4X103477366103529026Rat
1564541Steep1STING1 ER exit protein 1X116087626116114159Rat
1565307Rhox4greproductive homeobox 4GX116472094116477855Rat
1566184RGD1566184similar to Testis derived transcriptX114757064114815923Rat
1564643Bex1brain expressed, X-linked 1X9921901599220411Rat
1566159RGD1566159similar to preferentially expressed antigen in melanoma-like 3X9838386498391159Rat
1566163NrkNik related kinaseX102365747102462957Rat
1564955RGD1564955similar to fibrous sheath interacting protein 2X128076772128109233Rat
1565129RGD1565129similar to DNA segment, Chr 5, ERATO Doi 577, expressedX9203676692038211Rat
1565132Trmt2btRNA methyltransferase 2 homolog BX9742571297483821Rat
1565451Lonrf3LON peptidase N-terminal domain and ring finger 3X115565214115603886Rat
1593009Tceal7transcription elongation factor A like 7X9922840599230551Rat
1589746LOC315380similar to hormone-regulated proliferation-associated 20 kDa proteinX111803082111805851Rat
1589747LOC315370similar to heat shock protein 1, alphaX110207305110214134Rat
1583753LOC367889similar to zinc finger CCCH type containing 11AX8725441287309403Rat
1583754LOC367887similar to pescadillo homolog 1, containing BRCT domainX8582197085823704Rat
1583755LOC367882similar to L-lactate dehydrogenase B chain (LDH-B) (LDH heart subunit) (LDH-H)X8286236982863633Rat
1583757LOC367877similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)-likeX7799900178000358Rat
1583758LOC367876similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X7798593177986946Rat
1583760LOC367871similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X7522910475230103Rat
1590596LOC680564similar to ATP-binding cassette sub-family E member 1 (RNase L inhibitor) (Ribonuclease 4 inhibitor) (RNS4I)X102533328102535111Rat
1585932LOC679657hypothetical protein LOC679657X9880047298801302Rat
1590266Pabir3PABIR family member 3X133020162133083801Rat
1588662LOC691030similar to RIKEN cDNA 1700001F22X123264998123265711Rat
1591359LOC685654similar to Targeting protein for Xklp2 (Restricted expression proliferation associated protein 100) (p100) (Differentially expressed in cancerous and noncancerous lung cells 2) (DIL-2) (Protein FLS353) (Hepatocellular carcinoma-associated antigen 5...X8517415085177402Rat
1590643LOC680517similar to heterogeneous nuclear ribonucleoprotein MX111324802111327221Rat
1590569Lrch2leucine rich repeats and calponin homology domain containing 2X111091728111174225Rat
1590579Rbm41RNA binding motif protein 41X103605732103660381Rat
1588562Rap2cRAP2C, member of RAS oncogene familyX130504554130517671Rat
1593086Rtl8aretrotransposon Gag like 8AX133414027133415240Rat
1594339LOC503457similar to prohibitinX7483973474841509Rat
1594344LOC503425similar to 40S ribosomal protein S15 (RIG protein)X115101013115101602Rat
1593001LOC680327similar to Programmed cell death protein 6 (Probable calcium-binding protein ALG-2) (PMP41) (ALG-257)X9923528699235996Rat
1589457Trap1atumor rejection antigen P1AX102935503102940714Rat
1592975Tceal9transcription elongation factor A like 9X9924564599247715Rat
1583751LOC367895similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X9222156592222583Rat
1583752LOC367892similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1X9006726890070351Rat
1585885LOC680904similar to 60S acidic ribosomal protein P0 (L10E)X107809622107810665Rat
1586013LOC501532similar to Actin, cytoplasmic 2 (Gamma-actin)X109619907109621911Rat
1586014LOC501529similar to poly(rC) binding protein 2X111934105111936526Rat
1589048LOC685838hypothetical protein LOC685838X8756220687563474Rat
1587661Pabpc5poly A binding protein, cytoplasmic 5X8563776385641235Rat
1587678LOC688501similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor)X9447920894488070Rat
1564397Hs6st2heparan sulfate 6-O-sulfotransferase 2X130966547131261629Rat
1584453Zfp449zinc finger protein 449X134120820134140921Rat
1586289LOC691215hypothetical protein LOC691215X117556991117756327Rat
1359399Gpc4glypican 4X131644711131755349Rat
1588872Rpl31l1ribosomal protein L31-like 1X9230108992302388Rat
1587018Tex13btestis expressed 13BX104490937104511224Rat
1590738Esx1ESX homeobox 1X100449298100454452Rat
1584778LOC679764hypothetical protein LOC679764X9798794697988445Rat
1586454LOC688646similar to RIKEN cDNA 1700001F22X136154076136154621Rat
1583341Prr32proline rich 32X123977960123979917Rat
1583351LOC683743similar to Alpha-adducin (Erythrocyte adducin alpha subunit)X9506066595096671Rat
1588241LOC680725similar to prohibitinX109377891109378863Rat
1586244LOC691267similar to Protein C20orf155 homologX116707078116712324Rat
1588188Rtl4retrotransposon Gag like 4X108231052108641768Rat
1590912LOC298327similar to testis derived transcript isoform 1X114872762114873984Rat
1584861LOC501640similar to heterogeneous nuclear ribonucleoprotein A3X128002204128003535Rat
1584865LOC501602similar to peptidylprolyl isomerase DX7374598073749009Rat
1589721Glagalactosidase, alphaX9776922797780646Rat
1589724Col4a6collagen type IV alpha 6 chainX104766463105117499Rat
1586264Rhox13Rhox homeobox family member 13X116911157116917938Rat
1585304LOC688702similar to RIKEN cDNA 1700001F22X136825997136826693Rat
1588264Ripply1ripply transcriptional repressor 1X103436731103440904Rat
1586238LOC691273similar to Protein C20orf155 homologX116677939116679090Rat
1586239LOC691272similar to reproductive homeobox on X chromosome, 11X116688163116695111Rat
1588533LOC363500similar to UBX domain containing 4X102566466102569818Rat
1596566Cstf2cleavage stimulation factor subunit 2X9725355997279476Rat
1596590LOC683903similar to High mobility group protein 1 (HMG-1) (High mobility group protein B1) (Amphoterin) (Heparin-binding protein p30)X125866402125867050Rat
1596887PramePRAME nuclear receptor transcriptional regulatorX9856799498574654Rat
1595365LOC681466similar to prohibitinX105595157105596244Rat
1598343LOC300303similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38)X111554751111557418Rat
1596915Atg4aautophagy related 4A, cysteine peptidaseX104665345104765271Rat
1595418LOC681406similar to 40S ribosomal protein S2X7554917875549883Rat
1591860Slc25a53solute carrier family 25, member 53X100306917100319555Rat
1591868Zcchc18zinc finger, CCHC domain containing 18X100319535100322822Rat
1594526OcrlOCRL, inositol polyphosphate-5-phosphataseX127089508127140362Rat
1591514LOC683096similar to cactin CG1676-PAX8434539884347641Rat
1596907LOC678777hypothetical protein LOC678777X135460038135460939Rat
1593267LOC298175similar to stem cell derived neuronal survival protein precursorX119699856119700275Rat
1597157LOC305639similar to heat shock protein 8X124067885124069814Rat
1597164LOC301752similar to Zinc finger protein GLI2 (Tax helper protein)X8027241480278678Rat
1596788LOC681300similar to CXXC finger 5X126891110126892526Rat
1595433LOC680191similar to UPF0197 protein C11orf10 homologX9906774499069746Rat
1594149Tceal5transcription elongation factor A like 5X9920442299207373Rat
1596862Nxf5nuclear RNA export factor 5X9867625998698739Rat
1592859Ct45a9cancer/testis antigen family 45 member A9X134345175134355174Rat
1592872Ints6lintegrator complex subunit 6 likeX134258117134325706Rat
1589413RadxRPA1 related single stranded DNA binding protein, X-linkedX103089284103176840Rat
1596967LOC678717similar to eukaryotic translation initiation factor 3, subunit 12X120567963120568598Rat
1590192LOC685776similar to interferon stimulated exonuclease gene 20-like 2X8693218186933542Rat
1588607Rhox2Rhox homeobox family member 2X116507488116514240Rat
1595509LOC680113similar to CG6931-PAX9898103898981923Rat
1590178LOC685790similar to Protein CXorf48 (Tumor antigen BJ-HCC-20)X133882119133890487Rat
1596765LOC681325hypothetical protein LOC681325X7431269874316311Rat
1591601LOC683006similar to RIKEN cDNA 1700001F22X8261195982612568Rat
1591830Fam199xfamily with sequence similarity 199, X-linkedX100384502100413150Rat
1594336LOC503477similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)X124938528124939351Rat
1594337LOC503475similar to HMG2 like isoform 1X124791570124792075Rat
1588178LOC680788hypothetical protein LOC680788X108608117108608932Rat
1592556LOC685592similar to high-mobility group (nonhistone chromosomal) protein 1-like 1X8372857083729438Rat
1596697LOC681393similar to kinesin family member 18AX7539517375396382Rat
1598081Tcp11x2t-complex 11 family, X-linked 2X9859119198640800Rat
1598096Tceal6transcription elongation factor A (SII)-like 6X9833760698339600Rat
1598239LOC367975similar to B-cell translocation gene 1X116794228116805478Rat
1598243LOC367943similar to ribosomal protein L27X136090643136091029Rat
1598244LOC367942similar to heat shock protein 1, betaX135024943135027698Rat
1598247LOC367933similar to 60S ribosomal protein L7X131801463131802203Rat
1598248LOC367925similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)-likeX124948493124949499Rat
1598249LOC367923similar to 60S ribosomal protein L23aX104318144104318623Rat
1598251LOC367920similar to 14-3-3 protein zeta/delta (Protein kinase C inhibitor protein 1) (KCIP-1) (Mitochondrial import stimulation factor S1 subunit)X102992972102994146Rat
1598252Gstp-ps1glutathione-S-transferase, pi type, pseudogene 1X100215122100216335Rat
1598253LOC367905similar to transcription factor RAM2X9806867698070059Rat
1598351LOC295142similar to peptidylprolyl isomerase DX110524551110525661Rat
1596721LOC681369similar to karyopherin (importin) alpha 2X127072965127074744Rat
1595060LOC685388similar to family with sequence similarity 51, member A1 homologX8138915081390246Rat
1597791Ccdc160coiled-coil domain containing 160X132468141132478616Rat
1597720LOC685163similar to replication factor C (activator 1) 4X7774965177813367Rat
1596894LOC678792similar to transmembrane 9 superfamily member 2X135462751135497336Rat
1596455LOC685241similar to Ras-GTPase-activating protein binding protein 1 (ATP-dependent DNA helicase VIII) (GAP SH3-domain binding protein 1) (G3BP-1) (HDH-VIII)X7917813679192120Rat
1596429LOC685268similar to influenza virus NS1A binding protein isoform aX7982979679831682Rat
2301305Rhox3reproductive homeobox on X chromosome 3X116482945116487394Rat
2319867LOC100365002hypothetical LOC100365002X100462586100463155Rat
2319295LOC100361883mitochondrial ribosomal protein L30X115956680115957166Rat
2319323LOC100361854ribosomal protein S26-likeX107822116107822555Rat
2320143Cldn34c4claudin 34C4X9012972490135400Rat
2320172LOC100364893hypothetical LOC100364893X100427658100443097Rat
2320188LOC100364877high-mobility group box 4-likeX132703106132703824Rat
2320208LOC100364857hypothetical LOC100364857X100323267100324804Rat
2320301LOC100361364hypothetical LOC100361364X111799148111800089Rat
2322060Fam9bfamily with sequence similarity 9, member BX133519540133531969Rat
2320517LOC100361246presenilin associated, rhomboid-likeX9986870999870800Rat
2322092Arxes2adipocyte-related X-chromosome expressed sequence 2X9898560498987427Rat
2320731LOC100361129small nuclear ribonucleoprotein polypeptide G-likeX9329375893293987Rat
2322911LOC100360034dim gamma-tubulin 1-likeX7819498878233579Rat
2322277LOC100360376hypothetical LOC100360376X123861955123865635Rat
2321540LOC100360718vitamin K epoxide reductase complex subunit 1-like protein 1-likeX8214605882146443Rat
2323032LOC100363413hypothetical LOC100363413X112248482112249885Rat
2322455LOC100360296BRCA2-interacting protein-likeX133754358133765931Rat
2320944LOC100361016oocyte specific homeobox 5-likeX8648389386484900Rat
2322505LOC100360246hypothetical LOC100360246X133878251133881490Rat
2322525LOC100360225hypothetical LOC100360225X8012458480125689Rat
2322526LOC100360224hypothetical LOC100360224X122505315122506003Rat
2321752LOC100360605chromobox homolog 1X9866074598661862Rat
2323188LOC100363355hypothetical LOC100363355X112739910112743858Rat
2322607LOC100363642coiled-coil domain-containing protein 41-likeX133428069133430845Rat
2321855LOC100364002reproductive homeobox 9-likeX116560244116562636Rat
2321886Cpxcr1CPX chromosome region, candidate 1X8175690981794661Rat
2321147LOC100360912ATP synthase beta-subunit-likeX136361979136362619Rat
2321901LOC100360556developmental pluripotency associated 4X9928490099285780Rat
2321933LOC100360524Yip1 domain family, member 4-likeX8137062181380591Rat
2321936LOC100360521mitochondrial ribosomal protein S36-likeX122467665122467913Rat
2322721LOC100360128CDNA sequence BC049702-likeX117151627117153132Rat
2321164LOC100364395hypothetical LOC100364395X106867311106868233Rat
2321964LOC100363993testis expressed gene 16-likeX7694851177180601Rat
2323338Ube2d4l1ubiquitin-conjugating enzyme E2D 4 like 1X7727835477279285Rat
2323375LOC100363265rCG21417-likeX7458529274585827Rat
2323526Phf6PHD finger protein 6X132656658132699720Rat
2323548LOC100363191tubulin, gamma 1-likeX119455925119456663Rat
2324261LOC100362697mCG17902-likeX129741370129742631Rat
2324302LOC100362656hypothetical LOC100362656X110292959110298026Rat
4888584Mir1912microRNA 1912X110685978110686065Rat
2323810Cylc1cylicin 1X7610811176197431Rat
2323888Tex13atestis expressed 13AX101598992101601923Rat
2325338Mir351microRNA 351X132805563132805643Rat
2325352Mir764microRNA 764X110678597110678704Rat
2325372Mir448microRNA 448X110829918110830029Rat
2325420Mir20bmicroRNA 20bX132422211132422282Rat
2325422Mir542microRNA 542X132802623132802701Rat
2325439Mir652microRNA 652X106343293106343373Rat
2325446Mir363microRNA 363X132421791132421877Rat
2325467Mir322microRNA 322X132806594132806688Rat
2325506Mir106amicroRNA 106aX132422584132422661Rat
2325516Mir503microRNA 503X132806303132806373Rat
2325532Mir361microRNA 361X7824620678246275Rat
2325535Mir450a1microRNA 450a-1X132801380132801470Rat
2325583Mir92a2microRNA 92a-2X132421942132422033Rat
2325599Mir19b2microRNA 19b-2X132422072132422167Rat
4888609Mir3552microRNA 3552X110676724110676828Rat
2324557LOC100362376LRRGT00025-likeX113427370113427696Rat
2324583LOC100361139thymosin-like 8-likeX9867158698673655Rat
2324802LOC100363087estrogen receptor binding site associated antigen 9-likeX121289238121289878Rat
2325053Armcx4armadillo repeat containing, X-linked 4X9786052697870912Rat
6486824Rtl9retrotransposon Gag like 9X106708454106720607Rat
6489572LOC100912044protein phosphatase inhibitor 2-likeX113070197113072903Rat
6489636LOC100911920zinc finger protein ZPR1-likeX119774008119781347Rat
6486105LOC100912627actin, cytoplasmic 1-likeX8096709581106101Rat
6486733LOC100912508TBC1 domain family member 20-likeX100536405100541566Rat
6490707LOC100911846elongation factor 1-alpha 1-likeX7751305377514314Rat
6493681LOC100911253uncharacterized LOC100911253X111829130111944986Rat
6491579LOC100911640ATP synthase subunit gamma, mitochondrial-likeX130540508130544705Rat
6491583LOC100911639uncharacterized LOC100911639X7723290077316809Rat
6498758LOC100910451uncharacterized LOC100910451X133464033133470551Rat
6502223LOC100909656glyceraldehyde-3-phosphate dehydrogenase-likeX124869932124870723Rat
6499462LOC100910221methionine aminopeptidase 2-likeX102999695103003218Rat
6499494LOC100910230protein kinase C and casein kinase substrate in neurons protein 2-likeX103592017103593460Rat
6499811LOC10091018060S ribosomal protein L36a-likeX9730261497302943Rat
6503244LOC100909488putative heterogeneous nuclear ribonucleoprotein A1-like 3-likeX101154682101158781Rat
6503255Trpc5osTRPC5 opposite strandX108025172108044201Rat
6500424NkrfNFKB repressing factorX116126341116144577Rat
6497694Hmgn5high mobility group nucleosome binding domain 5X7408587174094488Rat
6498130LOC100910458nucleophosmin-likeX127960832127968169Rat
6501589LOC100909798heat shock cognate protein HSP 90-beta-likeX8318714783190538Rat
7527839LOC102555876uncharacterized LOC102555876X7561656275622421Rat
7519078Ct47b1cancer/testis antigen family 47, member B1X115651472115655191Rat
7524128LOC102554937transmembrane protein 182-likeX7463256474699574Rat
7489010Mir1298microRNA 1298X110744907110745045Rat
7506435LOC102555213uncharacterized LOC102555213X124466651124468789Rat
7528448LOC102550366uncharacterized LOC102550366X132805407132809653Rat
7536858LOC102549071cytochrome c oxidase subunit 7B, mitochondrial-likeX9779533897812718Rat
7662604LOC102555540uncharacterized LOC102555540X100091319100149630Rat
7663400LOC102548382glyceraldehyde-3-phosphate dehydrogenase-likeX118185012118206590Rat
7648445LOC102553815ras-related protein Rab-18-likeX9875134298755986Rat
7650932LOC102553553uncharacterized LOC102553553X115025996115030878Rat
7559699LOC102555573josephin-1-likeX8887692288878210Rat
7658474LOC102550129nuclear receptor subfamily 5 group A member 2-likeX110903809110905163Rat
7642968LOC102549210L-lactate dehydrogenase A chain-likeX122549678122552543Rat
7629268LOC102550604uncharacterized LOC102550604X7801815978068777Rat
7611199LOC102550812uncharacterized LOC102550812X125223196125303856Rat
7568867LOC102554698uncharacterized LOC102554698X7437797374430612Rat
7599539LOC102555852E3 ubiquitin-protein ligase RING2-likeX8983804789869276Rat
7586448Armcx5armadillo repeat containing, X-linked 5X9870959298747326Rat
7752647LOC102550607uncharacterized LOC102550607X131546740131727188Rat
7673510Sertm2serine rich and transmembrane domain containing 2X107727772107739795Rat
7724551LOC102550394uncharacterized LOC102550394X133475953133495771Rat
7739373LOC102555943igE-binding protein-likeX8873690488741617Rat
7668172LOC102549799MLV-related proviral Env polyprotein-likeX9342680893428804Rat
7669826LOC102553384protein crumbs homolog 1-likeX126583668126588654Rat
7703593LOC102551064glutamic acid-rich protein-likeX102771365102773657Rat
9214037LOC103690768histidine triad nucleotide-binding protein 1 pseudogeneX111887970111888349Rat
9098358LOC103690878syntaxin-3-likeX7369521573696108Rat
9177544LOC103694497serine/arginine-rich splicing factor 10 pseudogeneX7688550476894659Rat
9145805LOC103694587high mobility group protein B4-likeX130143801130144494Rat
9146728LOC10369088960S ribosomal protein L39 pseudogeneX106046331106046530Rat
9081780LOC103690899histidine triad nucleotide-binding protein 1 pseudogeneX114629601114636435Rat
9082754LOC103690083uncharacterized LOC103690083X130001844130069421Rat
9310051LOC103690872ATP synthase subunit epsilon, mitochondrial-likeX8550336985503521Rat
9242858LOC103690883zinc finger protein ZPR1 pseudogeneX101927495101928445Rat
9296500LOC103694491uncharacterized protein MGC39606 homologX134151306134154647Rat
9343299LOC10369088860S ribosomal protein L10a-likeX104902239104902979Rat
9345774LOC103690894uncharacterized LOC103690894X114922993114939876Rat
9462175LOC103690887late histone H2B.L4-likeX100270252100271157Rat
9463875LOC103690886uncharacterized LOC103690886X102894655102935220Rat
9317736LOC103690904high mobility group protein B4-likeX131862544131863238Rat
9439993LOC103694500fructose-bisphosphate aldolase A-likeX8435963784363266Rat
9406132LOC103694504uncharacterized LOC103694504X104462320104535699Rat
11359441LOC10834925260S ribosomal protein L23 pseudogeneX121754412121754975Rat
9854646Rps27a-ps4ribosomal protein S27a, pseudogene 4X9663504796635627Rat
11360244LOC108349237uncharacterized LOC108349237X8604740386058270Rat
11468204LOC108349189high mobility group protein B1 pseudogeneX107671273107672015Rat
11468725LOC108349245ribosome biogenesis protein NSA2 homolog pseudogeneX108116385108117264Rat
11444048LOC108349174heterogeneous nuclear ribonucleoprotein A1 pseudogeneX133546705133547990Rat
11429483Trnaa-ugc7transfer RNA alanine (anticodon UGC) 7X9987058199870649Rat
11441414LOC10834923960S ribosomal protein L27a-likeX9818488898185372Rat
11453602LOC108349244putative bifunctional UDP-N-acetylglucosamine transferase and deubiquitinase ALG13X107906320107968232Rat
11460839LOC108349181glyceraldehyde-3-phosphate dehydrogenase pseudogeneX8598628785987475Rat
11442345LOC108353271MLV-related proviral Env polyprotein-likeX9056914690569862Rat
11454080LOC108349247uncharacterized LOC108349247X113934651113951129Rat
11417755LOC108349198cytochrome c oxidase subunit NDUFA4 pseudogeneX126399588126399833Rat
11417756LOC108349258high mobility group protein B4-likeX136290250136290937Rat
11422950LOC108349177glyceraldehyde-3-phosphate dehydrogenase-likeX7629825476299034Rat
11355376LOC108349242uncharacterized LOC108349242X102830572102893928Rat
11427469LOC108352140high mobility group protein B4-likeX130942850130943537Rat
11373867LOC108349144high mobility group protein B4-likeX9466963994673320Rat
11373868LOC108349149igE-binding protein-likeX116664953116666436Rat
11409359LOC108349139ferritin light chain 1 pseudogeneX8239819382408875Rat
11409794LOC108349250actin, cytoplasmic 2-likeX117902835117903594Rat
11387321LOC108349153glyceraldehyde-3-phosphate dehydrogenase pseudogeneX123195230123198628Rat
11400154LOC108349184glyceraldehyde-3-phosphate dehydrogenase pseudogeneX9182138091822381Rat
11390008LOC108349241uncharacterized LOC108349241X100329242100378311Rat
11379849LOC108349140serine/threonine-protein kinase H1-likeX8328108483281644Rat
11391862LOC10834919560S ribosomal protein L7a pseudogeneX118279924118280718Rat
11393209LOC10834918260 kDa heat shock protein, mitochondrial pseudogeneX8683518186836288Rat
11501301Trnaa-ugc1transfer RNA alanine (anticodon UGC) 1X9934333399343401Rat
11478890LOC108349193glyceraldehyde-3-phosphate dehydrogenase pseudogeneX114319412114321561Rat
11481675Trnar-ccu9transfer RNA arginine (anticodon CCU) 9X7634360476343676Rat
11495543LOC108349145ribosome biogenesis protein NSA2 homologX100710076100710834Rat
11518088LOC108349199glyceraldehyde-3-phosphate dehydrogenase pseudogeneX126965477126966448Rat
11518134LOC108353282glyceraldehyde-3-phosphate dehydrogenase pseudogeneX127421637127422622Rat
11490737Trnaa-ugc9transfer RNA alanine (anticodon UGC) 9X9993776899937839Rat
14398596Mir450b-1microRNA mir-450b-1X132801525132801593Rat
41354497LOC120099455small nucleolar RNA SNORA42/SNORA80 familyX117874309117874425Rat
41378756LOC120099264protein SEC13 homologX123733294123742416Rat
41086782LOC120099263uncharacterized LOC120099263X108678823108701907Rat
41111313LOC120099214uncharacterized LOC120099214X133266846133276397Rat
41248886LOC120099541U2 spliceosomal RNAX8164846881648535Rat
41276463LOC120099209cation-dependent mannose-6-phosphate receptor-likeX8212929282130780Rat
41355609LOC120099489small nucleolar RNA SNORA17X117548920117549051Rat
41087468LOC120099434U7 small nuclear RNAX109520306109520359Rat
41113214LOC120099353poly(rC)-binding protein 2-likeX111940034111943599Rat
41113568LOC120099259cancer/testis antigen 55-likeX133346508133353120Rat
41140442LOC120099393U6 spliceosomal RNAX7564397475644077Rat
41204737LOC120099272high mobility group protein B4-likeX128868498128869190Rat
41284281LOC120099346heat shock protein HSP 90-beta-likeX124335515124337028Rat
41323624LOC12009914860S ribosomal protein L27-likeX8685312386853502Rat
41383546LOC120099269uncharacterized LOC120099269X124406821124447609Rat
41384159LOC120099427U6 spliceosomal RNAX111958839111958897Rat
41114019LOC120099532U2 spliceosomal RNAX7828899878289171Rat
41141688LOC120099545small nucleolar RNA U3X8899195888992172Rat
41206460LOC120099378uncharacterized LOC120099378X111708629111782670Rat
41279049LOC120099131U1 small nuclear ribonucleoprotein C-likeX9923878699239261Rat
41279441LOC120099252GTPase NRas-likeX116756806116763275Rat
41325721LOC120099203uncharacterized LOC120099203X125508395125647104Rat
41385866LOC120099452small nucleolar RNA SNORA36 familyX116009779116009910Rat
41206828LOC120099514small nucleolar RNA SNORA40X111573914111574039Rat
41286332LOC120099248uncharacterized LOC120099248X133770808133779325Rat
41287169LOC120099220uncharacterized LOC120099220X8938135989412344Rat
41287397LOC12009931439S ribosomal protein L30, mitochondrial-likeX131057674131123323Rat
41360768LOC120099250U1 small nuclear ribonucleoprotein C-likeX135673708135678865Rat
41360898LOC120099192uncharacterized LOC120099192X133723548133726977Rat
41387253LOC120099548U4 spliceosomal RNAX7843317578433322Rat
41388056LOC120099476small nucleolar RNA SNORA48X115916685115916825Rat
41092676LOC120099283uncharacterized LOC120099283X7903292179063019Rat
41146332NEWGENE_40938314transfer RNA serine (anticodon AGA)X121251163121251237Rat
41172807LOC120099486small nucleolar RNA SNORA17X9171808291718212Rat
41209783LOC120099535U2 spliceosomal RNAX106435897106435976Rat
41388172LOC12009935740S ribosomal protein S27-likeX120201439120201694Rat
41093266LOC120093120high mobility group protein B4-likeX126735348126736018Rat
41146938LOC120099169keratinocyte proline-rich protein-likeX116572842116577387Rat
41329173LOC120099414U6 spliceosomal RNAX134571259134571364Rat
41330088LOC120099493small nucleolar RNA SNORA17X112132302112132432Rat
41390138LOC120099559U6 spliceosomal RNAX9705592197056028Rat
41390843LOC120099469U1 spliceosomal RNAX127414084127414227Rat
41148923LOC120099218ankyrin repeat family A protein 2X7593952975941563Rat
41149933LOC120099459small nucleolar RNA SNORA1X116020859116020995Rat
41261795LOC120099162solute carrier family 25 member 39-likeX100463346100464246Rat
41331878LOC120099449small nucleolar RNA SNORA69X116327776116327909Rat
41365780LOC120099391U6 spliceosomal RNAX112716579112716685Rat
41391884LOC120099299uncharacterized LOC120099299X8032056680325582Rat
41096957LOC120099419U6 spliceosomal RNAX8659978286599884Rat
41178721LOC12009916460S ribosomal export protein NMD3-likeX103548909103550563Rat
41263292LOC120099373uncharacterized LOC120099373X7530711075308918Rat
41098979LOC120099312replication protein A 30 kDa subunit-likeX9257774092579234Rat
41122277LOC120099356uncharacterized LOC120099356X111913034111918433Rat
41122630LOC120099315uncharacterized LOC120099315X133820662133835679Rat
41180249LOC120099190cancer/testis antigen 55-likeX133631948133643916Rat
41191688LOC12009918060S ribosomal protein L18-likeX135789332135832927Rat
41266373LOC120099517small nucleolar RNA SNORA35X111101754111101882Rat
41367602LOC120099534U2 spliceosomal RNAX111874817111874960Rat
41394214LOC120099477small nucleolar RNA SNORA48X103852572103852714Rat
41124784LOC120099426U6 spliceosomal RNAX101822668101822772Rat
41157174LOC120099145uncharacterized protein DKFZp434B061-likeX7349866873506536Rat
41182025LOC120099389non-histone chromosomal protein HMG-17-likeX134940799134941081Rat
41370240LOC120099528U2 spliceosomal RNAX121161958121162061Rat
41182840LOC120099413U6 spliceosomal RNAX100205102100205204Rat
41290015LOC120099456small nucleolar RNA SNORA42/SNORA80 familyX9809551498095635Rat
41290160LOC120099490small nucleolar RNA SNORA17X9374025993740389Rat
41398432LOC120099160presenilins-associated rhomboid-like protein, mitochondrialX9987372399884618Rat
41070429LOC120099157presenilins-associated rhomboid-like protein, mitochondrialX9929558599325095Rat
41102901LOC120099155S-methyl-5'-thioadenosine phosphorylase-likeX9455035094551241Rat
41102911LOC120099409U6 spliceosomal RNAX8086248980862595Rat
41127291LOC120099501small nucleolar RNA SNORA17X106104376106104501Rat
41160492LOC120099249uncharacterized LOC120099249X107883646107885386Rat
41183603LOC120099417U6 spliceosomal RNAX115600746115600818Rat
41184806LOC120099274transcription factor BTF3-likeX134537822134538517Rat
41185080LOC120099499small nucleolar RNA SNORA17X121544402121544533Rat
41185184LOC120099448small Cajal body-specific RNA 13X115087944115088214Rat
41195353LOC120099189cancer/testis antigen 55-likeX133675275133686790Rat
41219408LOC120099313high mobility group protein B4-likeX9292327892923784Rat
41270159LOC120099173tyrosine-protein kinase Fer-likeX120637118120638167Rat
41292304LOC120099354poly(rC)-binding protein 2-likeX111924205111927837Rat
41348515LOC120099503small nucleolar RNA SNORA17X100437832100437946Rat
41228863LOC120099415U6 spliceosomal RNAX104370458104370564Rat
41271583LOC120099355uncharacterized LOC120099355X111831770111837168Rat
41271839LOC120099379protein LSM12 homologX100828120100828761Rat
41401096LOC120099495small nucleolar RNA SNORA17X108436348108436479Rat
41081948LOC120099277NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4-likeX127554839127557892Rat
41130514LOC120099418U6 spliceosomal RNAX114663691114663792Rat
41130542LOC120099176igE-binding protein-likeX123925106123930062Rat
41197927LOC120099544U2 spliceosomal RNAX107988410107988589Rat
41231029NEWGENE_40935195transfer RNA aspartic acid (anticodon AUC)X9771998797720067Rat
41294118LOC120099361uncharacterized LOC120099361X134003802134004865Rat
41295416LOC120099175uncharacterized LOC120099175X123357769123362512Rat
41403101LOC120099166uncharacterized protein C9orf85 homologX112816111112816567Rat
41199544LOC120099227ubiquitin-conjugating enzyme E2 D4-likeX8004879280049692Rat
41232192LOC120099390U6 spliceosomal RNAX133395235133395341Rat
41296444LOC120099161presenilins-associated rhomboid-like protein, mitochondrialX9989606999910250Rat
41083924LOC120099246peptidyl-prolyl cis-trans isomerase H-likeX110290281110293522Rat
41134219LOC120099292uncharacterized LOC120099292X105897251105928718Rat
41165605LOC120099150phosphatidylcholine:ceramide cholinephosphotransferase 1-likeX8786305087876463Rat
40997937LOC120099432U7 small nuclear RNAX9399593593995996Rat
40947786LOC120099287cancer/testis antigen 55-likeX133791523133815392Rat
40947923LOC120099179igE-binding protein-likeX133623908133628085Rat
41011122LOC120099352poly(rC)-binding protein 2-likeX111843404111847096Rat
41012133LOC120099421U6 spliceosomal RNAX127487350127487446Rat
40974168LOC120099402U6 spliceosomal RNAX136489271136489377Rat
40952035LOC120099451small nucleolar RNA SNORA31X7865198978652118Rat
40975408LOC120099475small nucleolar RNA SNORA48X116931587116931725Rat
41341586NEWGENE_40926764transfer RNA proline (anticodon AGG)X116027434116027514Rat
41012878LOC120099509small nucleolar RNA SNORA17X8390802883908132Rat
40954503LOC120099165uncharacterized LOC120099165X111787266111794068Rat
40955085LOC12009309640S ribosomal protein SA-likeX104461338104462092Rat
41014667LOC120099174MLV-related proviral Env polyprotein-likeX122620730122623492Rat
40955172LOC120099500small nucleolar RNA SNORA17X9567183995671970Rat
40956042LOC120099505small nucleolar RNA SNORA17X9561579295615915Rat
40979909LOC120099233ubiquitin-like protein FUBIX101185389101200516Rat
41000055LOC120099405U6 spliceosomal RNAX9153921191539317Rat
40929687LOC120099516small nucleolar RNA SNORA35X110671942110672069Rat
40981226LOC120099178MICOS complex subunit Mic19-likeX131314718131319739Rat
40930597LOC120099172high mobility group protein B1-likeX118058455118059327Rat
40982935LOC120099290embryonic testis differentiation protein-likeX133223810133233159Rat
40982944LOC120099450small nucleolar RNA SNORD61X135313247135313319Rat
40983609LOC120099404U6 spliceosomal RNAX125329941125330045Rat
40933887LOC12009916740S ribosomal protein S26-likeX113601665113609965Rat
40960803LOC120099217uncharacterized LOC120099217X116791039116793489Rat
40937392LOC120099270uncharacterized LOC120099270X133853071133859654Rat
41008958LOC120099186acyl-CoA-binding protein-likeX100522585100523021Rat
41009217NEWGENE_40933816transfer RNA valine (anticodon AAC)X105667790105667864Rat
41009708LOC120099216myelin-associated neurite-outgrowth inhibitor-likeX116834576116835163Rat
40940844LOC120099229SNF-related serine/threonine-protein kinase-likeX8195026781954558Rat
40967030LOC120099130pre-mRNA-splicing factor CWC22 homologX7655698276559633Rat
40992710LOC120099376uncharacterized LOC120099376X131866965131925528Rat
40969381LOC120099255high mobility group protein B4-likeX132449891132450601Rat
40943345LOC120099554U6 spliceosomal RNAX131991651131991757Rat
40970234LOC120099168proline-rich extensin-like protein EPR1X116571246116572833Rat
41046912LOC120099301uncharacterized LOC120099301X114425480114471782Rat
41047538LOC120099410U6 spliceosomal RNAX134157904134158009Rat
41075092LOC120099159uncharacterized LOC120099159X9935766399370850Rat
41075961LOC120099152egl nine homolog 1-likeX8943511689442460Rat
41314102LOC120099435U7 small nuclear RNAX8860912688609184Rat
41314230LOC12009938640S ribosomal protein S29-likeX9789357797893859Rat
41078949LOC120099170intraflagellar transport protein 52 homologX116594807116598029Rat
41246354LOC12009938740S ribosomal protein S4, X isoform-likeX103407238103415204Rat
41052230LOC120099395U6 spliceosomal RNAX132706378132706481Rat
41332437LOC120099256uncharacterized LOC120099256X7554148075552645Rat
41053422NEWGENE_40933816transfer RNA valine (anticodon AAC)X132606225132606299Rat
41255370LOC120099156protein ARMCX6-likeX9790971297911823Rat
41053489LOC120099422U6 spliceosomal RNAX9769232997692431Rat
41054660LOC120099153igE-binding protein-likeX9088882690893260Rat
41338750LOC120099282cysteine-rich perinuclear theca protein 1-likeX118533863118534605Rat
41152601LOC120099129uncharacterized LOC120099129X134141038134151302Rat
41153163LOC120099188cancer/testis antigen 55-likeX133589642133602900Rat
41031103LOC120099265translation machinery-associated protein 7-likeX133251419133251829Rat
41153418LOC120099454small nucleolar RNA SNORA44X9084139090841501Rat
41153492LOC120099446small nucleolar RNA SNORA57X9893422798934367Rat
41317710NEWGENE_6576120transfer RNA alanine (anticodon UGC)X9990403699904104Rat
41318060LOC120099151KAT8 regulatory NSL complex subunit 2-likeX8791810587921009Rat
41318334LOC120099191cancer/testis antigen 55-likeX133692711133709349Rat
41058279LOC120099401U6 spliceosomal RNAX7410304374103149Rat
41058816LOC120099332uncharacterized LOC120099332X133984318133985849Rat
41222918LOC120099392U6 spliceosomal RNAX8764108887641196Rat
41298450LOC120099240POU domain, class 5, transcription factor 1-likeX132624801132626269Rat
41033815LOC120099147high mobility group protein B4-likeX8561117685613253Rat
41337962LOC120099506small nucleolar RNA SNORA17X8957083089570959Rat
41226649LOC120099279elongin-C-likeX9334176093342187Rat
41301363LOC120099466U11 spliceosomal RNAX109679057109679190Rat
41036329LOC12009937760S ribosomal protein L18-likeX9820098198206496Rat
41064515LOC120099158presenilins-associated rhomboid-like protein, mitochondrialX9934318199344994Rat
41227588LOC120099519small nucleolar RNA SNORA26X127999183127999303Rat
41039055LOC120099146transmembrane emp24 domain-containing protein 2-likeX7452985574530417Rat
41237125LOC120099195uncharacterized LOC120099195X127174430127179462Rat
41304628LOC120099488small nucleolar RNA SNORA17X129753052129753183Rat
41041398LOC120099550U4 spliceosomal RNAX123006992123007124Rat
41041497LOC120099177FUN14 domain-containing protein 2-likeX124496808124497966Rat
41068559LOC120099349aminoacyl tRNA synthase complex-interacting multifunctional protein 1-likeX9038812490389081Rat
41240019LOC120099481small nucleolar RNA SNORA48X130775533130775672Rat
41307397LOC120099511small nucleolar RNA SNORA17X7907512079075243Rat
41021389LOC120099149triosephosphate isomerase-likeX8737596087449532Rat
41046187LOC120099487small nucleolar RNA SNORA17X104501295104501421Rat
41069800LOC120099457small nucleolar RNA SNORA42/SNORA80 familyX9801215798012273Rat
41022846LOC120099508small nucleolar RNA SNORA17X9842636198426479Rat
3053Esyt1extended synaptotagmin 17928848946199Rat
69058Matkmegakaryocyte-associated tyrosine kinase784569908465947Rat
2220Bsgbasigin (Ok blood group)7999317010000387Rat
62026Rps15ribosomal protein S15794160039417442Rat
68330Thop1thimet oligopeptidase 1786329118645339Rat
619751Gna15G protein subunit alpha 15781846328205508Rat
619994Suoxsulfite oxidase711031491107156Rat
61860Gng7G protein subunit gamma 7786974588761239Rat
3219Oaz1ornithine decarboxylase antizyme 1788838558886315Rat
61979Eef2eukaryotic translation elongation factor 2785332488538518Rat
70926Cyp4f1cytochrome P450, family 4, subfamily f, polypeptide 171201085012022497Rat
70930Kiss1rKISS1 receptor797851359790283Rat
69323Erbb3erb-b2 receptor tyrosine kinase 379945491015876Rat
71022Itga7integrin subunit alpha 7713601251388886Rat
3090Mipmajor intrinsic protein of lens fiber7643502654573Rat
3029Madcam1mucosal vascular addressin cell adhesion molecule 171003630110039703Rat
62016Nficnuclear factor I/C782782108309936Rat
70486Cdk2cyclin dependent kinase 2711298781137431Rat
620022Gzmmgranzyme M71001106510016841Rat
2659Gamtguanidinoacetate N-methyltransferase794485909451778Rat
2731Tle5TLE family member 5, transcriptional modulator781433578150295Rat
3825Tbxa2rthromboxane A2 receptor783833478390753Rat
620815Sgtasmall glutamine rich tetratricopeptide repeat co-chaperone alpha786536818670460Rat
620689Hcn2hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2799698019988839Rat
628845Timm13translocase of inner mitochondrial membrane 13788090698810172Rat
619749Gna11G protein subunit alpha 11781637528177636Rat
620914Tcf3transcription factor 3792805719302315Rat
620756Cirbpcold inducible RNA binding protein795338579538899Rat
727865Olr1082olfactory receptor 108271066466910665622Rat
620389Efna2ephrin A2795156359528071Rat
621407Csnk1g2casein kinase 1, gamma 2790767399095082Rat
628893Plpp2phospholipid phosphatase 271017591810184032Rat
620761Notch3notch receptor 371113298411184025Rat
70904Dgkadiacylglycerol kinase, alpha711487341175324Rat
69226Gpx4glutathione peroxidase 4796501869652982Rat
621705Grin3bglutamate ionotropic receptor NMDA type subunit 3B797308619737183Rat
621368Atp5f1bATP synthase F1 subunit beta7515454521858Rat
620939Timelesstimeless circadian regulator7654804678769Rat
620946Zbtb7azinc finger and BTB domain containing 7a785610158578243Rat
620832Akap8A-kinase anchoring protein 871131622411332523Rat
620184Giot1gonadotropin inducible ovarian transcription factor 171021560210236423Rat
620185Zfp347zinc finger protein 347774605437479378Rat
62080Cd63Cd63 molecule713251081340447Rat
621210Rpl41ribosomal protein L417977885978965Rat
620489Dnajc14DnaJ heat shock protein family (Hsp40) member C14712338561247349Rat
620340Slc1a6solute carrier family 1 member 671084183610870424Rat
620359Gls2glutaminase 27617252633424Rat
620330Cscitrate synthase7758074791421Rat
621380Prim1DNA primase subunit 17446342462526Rat
62047Ptbp1polypyrimidine tract binding protein 1798425749852332Rat
1303134Abca7ATP binding cassette subfamily A member 7796914529711466Rat
68354Scamp4secretory carrier membrane protein 4791015049113929Rat
621766Dapk3death-associated protein kinase 3785241828532552Rat
621811Fstl3follistatin like 3799246709929195Rat
620846Apba3amyloid beta precursor protein binding family A member 3784462128451310Rat
727823Plppr3phospholipid phosphatase related 3798311629842434Rat
1304813Rbms2RNA binding motif, single stranded interacting protein 27560787603881Rat
620325Pcsk4proprotein convertase subtilisin/kexin type 4793813669389589Rat
620873Il23ainterleukin 23 subunit alpha7721809723923Rat
708363Cyp4f4cytochrome P450, family 4, subfamily f, polypeptide 471171720811733507Rat
708364Cyp4f5cytochrome P450, family 4, subfamily f, polypeptide 571154404011558982Rat
1304599PolrmtRNA polymerase mitochondrial799595329969791Rat
620341Palmparalemmin798866349912389Rat
1303301Pan2poly(A) specific ribonuclease subunit PAN27729146747744Rat
1304898Prtn3proteinase 3798221239831300Rat
2673Gdf11growth differentiation factor 11713117321325211Rat
708343Hsd17b6hydroxysteroid (17-beta) dehydrogenase 67422466442008Rat
621372Atp5f1dATP synthase F1 subunit delta795606049565919Rat
1304737Zfr2zinc finger RNA binding protein 2784667688485593Rat
1303330Prss57serine protease 57799156679922996Rat
2498Cfdcomplement factor D798131489814871Rat
621044Rps26ribosomal protein S26710573321058882Rat
1306264Zfp763zinc finger protein 76371212948112147724Rat
1305205Mettl7bmethyltransferase like 7B713888761391526Rat
1306011Rnf126ring finger protein 126799393599946963Rat
1307513Pmelpremelanosome protein711382021148735Rat
2108Amhanti-Mullerian hormone789067768909184Rat
1305692SarnpSAP domain containing ribonucleoprotein712510961305335Rat
1305694Mrpl54mitochondrial ribosomal protein L54784528018455321Rat
1305354Lsm7LSM7 homolog, U6 small nuclear RNA and mRNA degradation associated788566668859119Rat
620177Fgf22fibroblast growth factor 22799476329956918Rat
1305642Ormdl2ORMDL sphingolipid biosynthesis regulator 2712478691250999Rat
1305857Syde1synapse defective Rho GTPase homolog 171103293111038917Rat
708365Cyp4f6cytochrome P450, family 4, subfamily f, polypeptide 671203027612058020Rat
1307137Shc2SHC adaptor protein 271006670510088926Rat
1302994Pa2g4proliferation-associated 2G47984795992264Rat
1309938Pip5k1cphosphatidylinositol-4-phosphate 5-kinase type 1 gamma783974068426030Rat
1307067R3hdm4R3H domain containing 4797904019797512Rat
1307968Elaneelastase, neutrophil expressed798172519819174Rat
1308556Sppl2bsignal peptide peptidase-like 2B788439188856642Rat
1304783Dohhdeoxyhypusine hydroxylase783214668326305Rat
61888Map2k2mitogen activated protein kinase kinase 2785907298610279Rat
1307389Mbd3methyl-CpG binding domain protein 3793129619320166Rat
1307722Mfsd12major facilitator superfamily domain containing 12783451718354050Rat
1307771WizWIZ zinc finger71136683711395279Rat
1333563Olr987olfactory receptor 987746106714611630Rat
1305037Baz2abromodomain adjacent to zinc finger domain, 2A7523204560911Rat
1305038Plk5polo-like kinase 5793467779367923Rat
727942Vom2r53vomeronasal 2 receptor, 5371026739010300055Rat
1333569Olr908olfactory receptor 908717672541768207Rat
1310013Ndufs7NADH:ubiquinone oxidoreductase core subunit S7794525569460135Rat
1308001Med16mediator complex subunit 16797986419811172Rat
1307194Sbno2strawberry notch homolog 2796055729649529Rat
1307622Atp8b3ATPase phospholipid transporting 8B3791755449195449Rat
1309508Reep6receptor accessory protein 6793739279380845Rat
1306644Dot1lDOT1 like histone lysine methyltransferase789177868959474Rat
1307206Ephx3epoxide hydrolase 371120681211212122Rat
1305728Mknk2MAPK interacting serine/threonine kinase 2790397719050832Rat
1305411Cdc34cell division cycle 34, ubiqiutin conjugating enzyme71001758810023586Rat
1306649Spryd4SPRY domain containing 47633400637564Rat
1304801S1pr4sphingosine-1-phosphate receptor 4782077678210043Rat
1306096Pym1PYM homolog 1, exon junction complex associated factor711777461200899Rat
1307124Ankrd52ankyrin repeat domain 527806829820481Rat
1307213Plekhj1pleckstrin homology domain containing J1789154928920491Rat
1305607Adamtsl5ADAMTS-like 5793626239371248Rat
1310445Diras1DIRAS family GTPase 1786879648692828Rat
1332775Olr1064olfactory receptor 1064766632966664234Rat
1310434Neurod4neuronal differentiation 4770900487102018Rat
1333941Olr1072olfactory receptor 1072770200927021060Rat
1333943Olr972-psolfactory receptor pseudogene 972741848294185069Rat
1333822Olr884-psolfactory receptor pseudogene 884725594582560395Rat
1308627Sf3a2splicing factor 3a, subunit 2789095078916104Rat
1308642Nacanascent polypeptide associated complex subunit alpha7468862481992Rat
1333635Olr1060olfactory receptor 1060765570466558002Rat
1333638Olr1019-psolfactory receptor pseudogene 1019755758115576760Rat
1333501Olr1025-psolfactory receptor pseudogene 1025756853885685794Rat
1333216Olr979-psolfactory receptor pseudogene 979743358804336766Rat
1307278Mier2MIER family member 271015350110169381Rat
1307282Brd4bromodomain containing 471121644611296029Rat
1333893Olr927olfactory receptor 927729923212993283Rat
1333342Olr1021-psolfactory receptor pseudogene 1021756105525611487Rat
1333348Olr1001-psolfactory receptor pseudogene 1001750624825063476Rat
1332665Olr1032-psolfactory receptor pseudogene 1032758606685861606Rat
1333271Olr966-psolfactory receptor pseudogene 966738954143896349Rat
1333273Olr953-psolfactory receptor pseudogene 953736219533622988Rat
1333959Olr1013-psolfactory receptor pseudogene 1013753800885380930Rat
1333193Olr1094-psolfactory receptor pseudogene 109471247741912478375Rat
1333194Olr1020olfactory receptor 1020755903555596395Rat
1333196Olr984olfactory receptor 984745403074541242Rat
1333198Olr1051olfactory receptor 1051762953166296251Rat
1333516Olr1061olfactory receptor 1061765758536576815Rat
1333518Olr925-psolfactory receptor pseudogene 925729196812920591Rat
1309581Tmprss9transmembrane serine protease 9788103208834914Rat
1309557Rnf41ring finger protein 417838160876869Rat
1333210Olr1062-psolfactory receptor pseudogene 1062765965936597440Rat
1333295Olr919-psolfactory receptor pseudogene 919727721602773092Rat
1359200Akap8lA-kinase anchoring protein 8 like71133267111362287Rat
1333896Olr967-psolfactory receptor pseudogene 967739194503920384Rat
1333137Olr1048-psolfactory receptor pseudogene 1048761849396185874Rat
1333182Olr1088olfactory receptor 108871111176811115501Rat
1333091Olr1008-psolfactory receptor pseudogene 1008752578565258836Rat
1333314Olr1003-psolfactory receptor pseudogene 1003751097885110713Rat
1332632Olr1055olfactory receptor 1055764224216423365Rat
1333511Olr960olfactory receptor 960737764993777440Rat
1333260Olr931olfactory receptor 931731025703103508Rat
1333261Olr923-psolfactory receptor pseudogene 923728893542890287Rat
1333169Olr1045-psolfactory receptor pseudogene 1045761386216139135Rat
1332643Olr982olfactory receptor 982744614314462366Rat
1333582Olr905olfactory receptor 905718461261847064Rat
1334006Olr928-psolfactory receptor pseudogene 928729477062948650Rat
1334235Olr898olfactory receptor 898720438472044806Rat
1334244Olr887-psolfactory receptor pseudogene 887724838312484734Rat
1334245Olr975-psolfactory receptor pseudogene 975742523894253377Rat
1333766Olr941-psolfactory receptor pseudogene 941733370963338043Rat
1332784Olr1034-psolfactory receptor pseudogene 1034758932465894005Rat
1332785Olr1015-psolfactory receptor pseudogene 1015754627375463720Rat
1333120Olr978-psolfactory receptor pseudogene 978743161954317065Rat
1332607Olr1018-psolfactory receptor pseudogene 1018755173945518273Rat
1333104Olr917olfactory receptor 917717993581800293Rat
1333107Olr885-psolfactory receptor pseudogene 885725485212549393Rat
1332932Olr963-psolfactory receptor pseudogene 963738336663834622Rat
1334177Olr1040-psolfactory receptor pseudogene 1040760171046017927Rat
1334178Olr1069olfactory receptor 1069768466786847622Rat
1310863Slc39a3solute carrier family 39 member 3786768458682846Rat
1334021Olr977-psolfactory receptor pseudogene 977742896704290193Rat
1333706Olr1004-psolfactory receptor pseudogene 1004751475835148535Rat
1333710Olr936olfactory receptor 936731927913193732Rat
1311136Tmem259transmembrane protein 259797241969730932Rat
1332824Olr886olfactory receptor 886725249852525929Rat
1332830Olr998-psolfactory receptor pseudogene 998750085335009484Rat
1309019Rasal3RAS protein activator like 371139609011411349Rat
1333620Olr1085olfactory receptor 108571078591110786843Rat
1333631Olr1091olfactory receptor 109171245073412451668Rat
1311781Casp14caspase 1471092975910932591Rat
1333115Olr1022olfactory receptor 1022756177905618728Rat
1333361Olr1014olfactory receptor 1014754009185401862Rat
1332592Olr944-psolfactory receptor pseudogene 944734030573403991Rat
1332593Olr1067olfactory receptor 1067767749156775862Rat
1333230Olr935-psolfactory receptor pseudogene 935731722413173184Rat
1333917Olr942-psolfactory receptor pseudogene 942733481583348967Rat
1333875Olr1083olfactory receptor 108371069914210700074Rat
1332810Olr1058olfactory receptor 1058764837946503535Rat
1332814Olr1050-psolfactory receptor pseudogene 1050762617076262633Rat
1333363Olr1057olfactory receptor 1057764749946475932Rat
1333277Olr888-psolfactory receptor pseudogene 888723262472327141Rat
1333282Olr949-psolfactory receptor pseudogene 949735522733553203Rat
1332624Olr961-psolfactory receptor pseudogene 961738011573802206Rat
1332748Olr1038-psolfactory receptor pseudogene 1038759597895960725Rat
1332753Olr1030-psolfactory receptor pseudogene 1030758020605803014Rat
1332762Olr1031-psolfactory receptor pseudogene 1031758470545847988Rat
1333396Olr940-psolfactory receptor pseudogene 940733013383302271Rat
1333351Olr1027-psolfactory receptor pseudogene 1027757142305715179Rat
1333352Olr900-psolfactory receptor pseudogene 900719788131979757Rat
1308653Stk11serine/threonine kinase 11795745539591315Rat
1308659Ap3d1adaptor related protein complex 3 subunit delta 1789702499005651Rat
1308662Arhgap45Rho GTPase activating protein 45796748739690286Rat
1311649Stat2signal transducer and activator of transcription 27702565718349Rat
1333992Olr930-psolfactory receptor pseudogene 930730916983092261Rat
1310212RGD1310212similar to KIAA1111-like protein71219443712200509Rat
1560687RGD1560687similar to Ferritin light chain (Ferritin L subunit)71222010912221018Rat
1333414Olr938-psolfactory receptor pseudogene 938732563533257288Rat
1332796Olr1089-psolfactory receptor pseudogene 108971112915711129811Rat
1332880Olr1059olfactory receptor 1059765192076520187Rat
1332883Olr991olfactory receptor 991747178134718764Rat
1332886Olr970-psolfactory receptor pseudogene 970741396014140487Rat
1332888Olr943olfactory receptor 943733893363390274Rat
1310260Odf3l2outer dense fiber of sperm tails 3-like 271004947210065626Rat
1308729Zfp563zinc finger protein 56371219841112266003Rat
1308796Cyp4f39cytochrome P450, family 4, subfamily f, polypeptide 3971142680611505553Rat
1333963Olr981-psolfactory receptor pseudogene 981744484104449130Rat
1333970Olr922olfactory receptor 922728616642864411Rat
1333976Olr957-psolfactory receptor pseudogene 957737509163751829Rat
1308713Fzr1fizzy and cell division cycle 20 related 1783320298343953Rat
1309312AtcayATCAY kinesin light chain interacting caytaxin784877638511527Rat
1333559Olr983-psolfactory receptor pseudogene 983744844654485431Rat
1309247Tjp3tight junction protein 3784276508446279Rat
1307988IlvblilvB acetolactate synthase like71103987011049924Rat
1305966Klf16Kruppel-like factor 16791385039148322Rat
1306665Tle2TLE family member 2, transcriptional corepressor781190498135385Rat
1308187Mob3aMOB kinase activator 3A790104909027888Rat
1305216Sirt6sirtuin 6780823128087776Rat
1308152Creb3l3cAMP responsive element binding protein 3-like 3786226148631053Rat
1307564Bloc1s1biogenesis of lysosomal organelles complex-1, subunit 1713474951351103Rat
1305299Arid3aAT-rich interaction domain 3A797552919781260Rat
1308256Apc2APC regulator of WNT signaling pathway 2793923369414364Rat
1333408Olr1039-psolfactory receptor pseudogene 1039759873595988303Rat
1308158Nabp2nucleic acid binding protein 27830949836551Rat
1306489Rab5bRAB5B, member RAS oncogene family711094491128348Rat
1311376Mmp19matrix metallopeptidase 19712212291229555Rat
1310646Wdr18WD repeat domain 18797402459748041Rat
1307185CbarpCACN subunit beta associated regulatory protein795666379575204Rat
1309629Midnmidnolin795481009559605Rat
1309355Nclnnicalin782119788221938Rat
1310322Slc39a5solute carrier family 39 member 57822873830865Rat
1309235Hmg20bhigh mobility group 20 B783689348373650Rat
1309240Thegtheg spermatid protein71012739410137556Rat
1308849Rdh5retinol dehydrogenase 5713405451347361Rat
1309872Rexo1RNA exonuclease 1 homolog791540509173454Rat
1332680Olr897-psolfactory receptor pseudogene 897720682842068589Rat
1311384Aponapolipoprotein N7686943688346Rat
1311385Ankrd24ankyrin repeat domain 24780616348081142Rat
1332702Olr1012olfactory receptor 1012753650245365962Rat
1332867Olr1092olfactory receptor 109271247744912478405Rat
1308340Pwwp3aPWWP domain containing 3A, DNA repair factor794651809482053Rat
1333434Olr1076olfactory receptor 107671053601810536974Rat
1332854Olr948-psolfactory receptor pseudogene 948735191503519673Rat
1333832Olr969-psolfactory receptor pseudogene 969741234854123998Rat
1333834Olr993-psolfactory receptor pseudogene 993747473054748244Rat
1333837Olr907olfactory receptor 907727141172715052Rat
1308737Pias4protein inhibitor of activated STAT, 4785463128559838Rat
1332790Olr971-psolfactory receptor pseudogene 971741771484178031Rat
1305280Dazap1DAZ associated protein 1794236739448116Rat
1310576Mex3dmex-3 RNA binding family member D793255759332705Rat
1332717Olr996olfactory receptor 996749711944972129Rat
1333243Olr1029olfactory receptor 1029757900705791008Rat
1333256Olr968-psolfactory receptor pseudogene 968739520393952943Rat
1333580Olr974-psolfactory receptor pseudogene 974742323644233310Rat
1359682Abhd17aabhydrolase domain containing 17A, depalmitoylase791243329132762Rat
1561913Ptges3prostaglandin E synthase 37490698507759Rat
1334198Olr932olfactory receptor 932731217413122676Rat
1334201Olr952olfactory receptor 952736088453609783Rat
1566094Btbd2BTB domain containing 2790586099075341Rat
1334336Olr1046-psolfactory receptor pseudogene 1046761509746151399Rat
1562447Coq10acoenzyme Q10A7792089798392Rat
1333787Olr955-psolfactory receptor pseudogene 955737017113702661Rat
1334345Olr988-psolfactory receptor pseudogene 988746311284632075Rat
1334347Olr945-psolfactory receptor pseudogene 945734321143432544Rat
1334351Olr1036-psolfactory receptor pseudogene 1036759327525933690Rat
1564020Morc2bmicrorchidia 2B71231434112318421Rat
1561354C2cd4cC2 calcium-dependent domain containing 4C71009065110095426Rat
1334358Olr906olfactory receptor 906718212641822202Rat
1334317Olr937olfactory receptor 937732326983233633Rat
1334322Olr916olfactory receptor 916726798302680783Rat
1334363Olr1011-psolfactory receptor pseudogene 1011753484525349353Rat
1334366Olr965-psolfactory receptor pseudogene 965738641733865045Rat
1561530Tle6TLE family member 6, subcortical maternal complex member781070508118639Rat
1359692Zfp799zinc finger protein 79971189422411910809Rat
1334367Olr1047-psolfactory receptor pseudogene 1047761786246179520Rat
1563255Gipc3GIPC PDZ domain containing family, member 3783749418383281Rat
1562342Tmem198btransmembrane protein 198b712297091234920Rat
727944Zfp472zinc finger protein 47271207462312082890Rat
1332732Olr1063olfactory receptor 1063766466586647596Rat
1334106Olr1052olfactory receptor 1052763183596319295Rat
1334110Olr947olfactory receptor 947735115693512507Rat
1564722Izumo4IZUMO family member 4790072769010428Rat
1334314Olr933-psolfactory receptor pseudogene 933731433523144308Rat
1334254Olr892olfactory receptor 892721886012189539Rat
1333306Olr1077olfactory receptor 107771057213710573066Rat
1333462Olr954olfactory receptor 954736648563665809Rat
1333464Olr973-psolfactory receptor pseudogene 973742127924213727Rat
1333468Olr951olfactory receptor 951735919053592849Rat
1334038Olr939-psolfactory receptor pseudogene 939732735653274502Rat
1560713Apofapolipoprotein F7700688702130Rat
1332740Olr1073olfactory receptor 107371048999810490933Rat
1559596Cyp4f40cytochrome P450, family 4, subfamily f, polypeptide 4071169164811707437Rat
1334179Olr989-psolfactory receptor pseudogene 989746565044657453Rat
1333792Olr912-psolfactory receptor pseudogene 912725835202584465Rat
1333793Olr903olfactory receptor 903718997661900701Rat
1333072Olr1049olfactory receptor 1049762198716220806Rat
1359127RGD1359127similar to RIKEN cDNA 2310011J03793902559392383Rat
1333543Olr1090olfactory receptor 109071235850912359465Rat
1333844Olr921olfactory receptor 921728292382830173Rat
1334124Olr1054-psolfactory receptor pseudogene 1054763866936387192Rat
1334130Olr1080-psolfactory receptor pseudogene 108071062482310624978Rat
1334133Olr1043-psolfactory receptor pseudogene 1043760880136088974Rat
1334137Olr994-psolfactory receptor pseudogene 994747722054773140Rat
1332999Olr980-psolfactory receptor pseudogene 980744208914421852Rat
1334014Olr1086olfactory receptor 108671081062410811586Rat
1334017Olr896olfactory receptor 896720993512100301Rat
1334098Olr901olfactory receptor 901719699451970889Rat
1334100Olr1035-psolfactory receptor pseudogene 1035759193275920235Rat
1334103Olr913-psolfactory receptor pseudogene 913726049762605927Rat
1334186Olr999-psolfactory receptor pseudogene 999750170425017999Rat
1334191Olr918-psolfactory receptor pseudogene 918727356142736501Rat
1333044Olr1081olfactory receptor 108171064223210643185Rat
1333877Olr1009-psolfactory receptor pseudogene 1009753054595305671Rat
1333077Olr1041-psolfactory receptor pseudogene 1041760407896041723Rat
1333880Olr904-psolfactory receptor pseudogene 904718767111877630Rat
1333599Olr1037-psolfactory receptor pseudogene 1037759450395945969Rat
1334056Olr880olfactory receptor 880715909871591925Rat
1334057Olr986-psolfactory receptor pseudogene 986745919344592239Rat
1309080Gadd45bgrowth arrest and DNA-damage-inducible, beta787780048780306Rat
1559940RGD1559940similar to ubiquitin-conjugating enzyme E2G 1 (UBC7 homolog, C. elegans)739881463988702Rat
1334080Olr890-psolfactory receptor pseudogene 890722131332213848Rat
1333657Olr1078olfactory receptor 107871057800810579009Rat
1333658Olr1075olfactory receptor 107571051556710516526Rat
1332890Olr894olfactory receptor 894721264052127340Rat
1333857Olr1017-psolfactory receptor pseudogene 1017755044985505421Rat
1333862Olr985-psolfactory receptor pseudogene 985745474654548223Rat
1334229Olr899-psolfactory receptor pseudogene 899720286282029568Rat
1334418Olr1007olfactory receptor 1007752265205227464Rat
1334420Olr1028-psolfactory receptor pseudogene 1028757348785735801Rat
1334117Olr1042-psolfactory receptor pseudogene 1042760458296046492Rat
1334119Olr946-psolfactory receptor pseudogene 946734910433492262Rat
1334401Olr934-psolfactory receptor pseudogene 934731595813160081Rat
1334409Olr1071olfactory receptor 1071769822236983164Rat
1334410Olr1024olfactory receptor 1024756660685666991Rat
1332908Olr1065olfactory receptor 1065766783856679323Rat
1332909Olr1016olfactory receptor 1016754725185473441Rat
1332910Olr878olfactory receptor 878715021601503089Rat
1332915Olr914-psolfactory receptor pseudogene 914726248332625752Rat
1332917Olr1056-psolfactory receptor pseudogene 1056731217413122676Rat
1332923Olr902-psolfactory receptor pseudogene 902719453791946317Rat
1334413Olr879olfactory receptor 879715463161547254Rat
1333022Olr1006olfactory receptor 1006751978315198781Rat
1333027Olr926-psolfactory receptor pseudogene 926730219193022874Rat
1333055Olr1070olfactory receptor 1070768682546869213Rat
1333721Olr882-psolfactory receptor pseudogene 882716620161662790Rat
1333723Olr1066-psolfactory receptor pseudogene 1066767221976723135Rat
1333726Olr1068olfactory receptor 1068768086486809595Rat
1333548Olr875olfactory receptor 875714309241431862Rat
1333549Olr1002olfactory receptor 1002750998575100795Rat
1333557Olr920olfactory receptor 920728062292807161Rat
1332936Olr1033-psolfactory receptor pseudogene 1033758679435868895Rat
1332938Olr1023-psolfactory receptor pseudogene 1023756405845641533Rat
1334381Olr1010-psolfactory receptor pseudogene 1010753304105331346Rat
1334369Olr924-psolfactory receptor pseudogene 924729039492904302Rat
1334330Olr976-psolfactory receptor pseudogene 976742705854271523Rat
1334213Olr990olfactory receptor 990746794884680375Rat
1334215Olr929-psolfactory receptor pseudogene 929730681753069087Rat
1333001Olr895-psolfactory receptor pseudogene 895721194182120170Rat
1333010Olr893-psolfactory receptor pseudogene 893721466212147537Rat
1333014Olr964olfactory receptor 964738418533842797Rat
1334220Olr881olfactory receptor 881716436001644535Rat
1334221Olr1005-psolfactory receptor pseudogene 1005751856325186548Rat
1332891LOC288803olfactory receptor 883-like726552362656169Rat
1333670Olr877olfactory receptor 877714520561452994Rat
1561463RGD1561463similar to Sfrs7 protein777811367782325Rat
1334430Olr956olfactory receptor 956737138263714764Rat
1334433Olr889olfactory receptor 889722572092258171Rat
1332959Olr1053-psolfactory receptor pseudogene 1053763735216374464Rat
1333737Olr1026-psolfactory receptor pseudogene 1026757065935707508Rat
1332976Olr950olfactory receptor 950735722523573229Rat
1332978Olr995olfactory receptor 995749477184948653Rat
1334246Olr1087olfactory receptor 108771098593810986879Rat
1334279Olr1084olfactory receptor 108471074394810744880Rat
1332898Olr997-psolfactory receptor pseudogene 997750002565001195Rat
1334394Olr992-psolfactory receptor pseudogene 992747307484731680Rat
1334395Olr1000olfactory receptor 1000750368825037817Rat
1560314RGD1560314RGD156031471216346312180606Rat
1359183Pglyrp2peptidoglycan recognition protein 271141867411432162Rat
1332970Olr962olfactory receptor 962738225513823929Rat
1332973Olr891-psolfactory receptor pseudogene 891722079512208886Rat
1333801Olr1079olfactory receptor 107971059986610600798Rat
1585088LOC691328similar to Small Glutamine-rich Tetratrico repeat protein family member (sgt-1)71177407211776194Rat
1561655Cyp4f17cytochrome P450, family 4, subfamily f, polypeptide 1771151898511536208Rat
1585096LOC691319similar to Heterogeneous nuclear ribonucleoprotein A1 (Helix-destabilizing protein) (Single-strand RNA-binding protein) (hnRNP core protein A1) (HDP)71162324111624665Rat
1585102Cyp4f37cytochrome P450, family 4, subfamily f, polypeptide 3771157257311595063Rat
1587266Rps15-ps2ribosomal protein S15, pseudogene 27966395966881Rat
1587404LOC691186similar to L-lactate dehydrogenase A chain (LDH-A) (LDH muscle subunit) (LDH-M)71164181011643427Rat
1587525LOC689855similar to 60S ribosomal protein L5750814005082284Rat
1587418LOC691170similar to zinc finger protein 84 (HPF2)71043017710451419Rat
1565016Celf5CUGBP, Elav-like family member 5782257878250322Rat
1563803Lmnb2lamin B2787926288808665Rat
1584020LOC690150similar to 60S ribosomal protein L5763521116353011Rat
1562114Fam174cfamily with sequence similarity 174 member C795319959533705Rat
1563634Cactincactin, spliceosome C complex subunit783913968397219Rat
1591005Onecut3one cut homeobox 3792179179219011Rat
1591117LOC689510similar to RRS1 ribosome biogenesis regulator homolog740156714016768Rat
1587846Zc3h10zinc finger CCCH type containing 107973415977742Rat
1592209Lingo3leucine rich repeat and Ig domain containing 3788690258878431Rat
1591037LOC689590similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38)743525654353547Rat
1587698LOC687281hypothetical protein LOC68728171106366611064245Rat
1589072Cnpy2canopy FGF signaling regulator 27748877754352Rat
1589807Cnn2calponin 2797125059719711Rat
1589817Polr2eRNA polymerase II, I and III subunit E796666959670638Rat
1586629Robld3-ps1roadblock domain containing 3, pseudogene 1711691601169716Rat
1590985Uqcr11ubiquinol-cytochrome c reductase, complex III subunit XI793050429309753Rat
1589019Myl6myosin light chain 67910764914062Rat
1593449LOC690617hypothetical protein LOC690617783456678347429Rat
1597091LOC366789similar to prefoldin 1710494451049830Rat
1588730LOC689758similar to Ribosome biogenesis regulatory protein homolog747799444782035Rat
1595680Mispmitotic spindle positioning798703909886541Rat
1597368LOC690320similar to replication factor C (activator 1) 4769184366919609Rat
1597704Smarcc2SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 27881844910090Rat
1596084Jsrp1junctional sarcoplasmic reticulum protein 1788894868906055Rat
1596088Zfp709l1zinc finger protein 709-like 1776838077708257Rat
1598321LOC314605similar to glyceraldehyde-3-phosphate dehydrogenase71106477411066307Rat
1596203LOC689100similar to ubiquitin specific protease 12729422872943503Rat
1592231LOC690733similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38)723152222316180Rat
1593829LOC685427hypothetical protein LOC6854277367498370106Rat
1588613Tpgs1tubulin polyglutamylase complex subunit 171002984210035764Rat
1594374Ccdc105coiled-coil domain containing 10571090044910907673Rat
1595804LOC366841similar to DNA methyltransferase 1-associated protein 171241337912423417Rat
1595806LOC366820similar to syntaxin 8775949497595720Rat
1595807LOC366818hypothetical gene supported by NM_031656773999607400812Rat
1597136Zfp870zinc finger protein 87071199014612003813Rat
1642417Adat3adenosine deaminase, tRNA-specific 3791090709113673Rat
1642422LOC100125368zinc finger protein LOC100125368780376498060640Rat
2319727LOC100361646hypothetical LOC100361646737321903733053Rat
2319157Ikzf4IKAROS family zinc finger 4710632831102940Rat
2320103LOC100361462hypothetical LOC10036146271180010611801074Rat
2320346LOC100361319hypothetical LOC1003613197237890238385Rat
2322086LOC100360470hypothetical protein LOC100360470779515297956270Rat
2322971LOC100363474hypothetical LOC100363474717836431787563Rat
2322464Zfp952zinc finger protein 95271208396712115261Rat
2322533LOC100360217hypothetical LOC100360217768387886839324Rat
2324237Smim24small integral membrane protein 24783105308316686Rat
2323960LOC100362818hypothetical LOC100362818774025967407032Rat
6485596LOC100912823zinc finger protein 709-like777560787780124Rat
6491887LOC100911571olfactory receptor 6C2-like736648563665809Rat
6486791Nmrk2nicotinamide riboside kinase 2785148558517916Rat
6486381LOC100912582zinc finger protein 14-like71192949311960641Rat
6495155LOC10091112440S ribosomal protein S8-like750983355098975Rat
6487604LOC100912294zinc finger protein 709-like779269518018178Rat
6491577LOC100911638protein lin-28 homolog A-like752514005252009Rat
6499070LOC100910391ubiquitin carboxyl-terminal hydrolase 15-like768928246893632Rat
6502389LOC100909682zinc finger protein 709-like779856378001173Rat
6503044LOC100909569zinc finger protein 91-like778533637891014Rat
6496615LOC100910785serine/arginine-rich splicing factor 7-like777091487709940Rat
6503580LOC100909435olfactory receptor 6C3-like727637082764640Rat
6504242LOC10090940240S ribosomal protein S8-like757882805788967Rat
6497573LOC100910577zinc finger protein 709-like772698797316286Rat
7496486LOC102555134uncharacterized LOC10255513471098354911032788Rat
7506385LOC102552675uncharacterized LOC102552675783181578321313Rat
7531244LOC102546572zinc finger protein 709-like71184607711868732Rat
7535686LOC102553301uncharacterized LOC102553301787127068721492Rat
7645610LOC102549817zinc finger protein 124-like771363657225579Rat
7663771LOC102549402uncharacterized LOC10254940271086349010868060Rat
7631021LOC102551804uncharacterized LOC102551804778908277923813Rat
7619273LOC102549971ubiquitin-conjugating enzyme E2 G1-like748908074891359Rat
7553740LOC102552420uncharacterized LOC102552420782492378275456Rat
7693709LOC102551996uncharacterized LOC102551996780896368103948Rat
7695129LOC102552770uncharacterized LOC102552770783279688331918Rat
7678463LOC10255282640S ribosomal protein S23-like7941013941989Rat
7689066LOC102548621uncharacterized LOC10254862171206288112074640Rat
7746372LOC102551925uncharacterized LOC1025519257694744700780Rat
7721730LOC102550657zinc finger protein 569-like776026517635574Rat
7709067LOC102552827uncharacterized LOC102552827783713818372630Rat
7678898LOC102553109uncharacterized LOC102553109713276281337406Rat
7709327LOC102546466ATP synthase subunit g, mitochondrial-like71188938611890285Rat
7681428LOC102555838uncharacterized LOC1025558387373479385755Rat
7730226LOC102553232uncharacterized LOC102553232785424578545534Rat
9143397LOC103692766histone H2A.Z pseudogene743099024310418Rat
9153547LOC103692762MLV-related proviral Env polyprotein-like747085064711873Rat
9216279LOC103692782nuclear transport factor 2 pseudogene71196079111962329Rat
9323204LOC10369276740S ribosomal protein S8 pseudogene737155543720395Rat
9374119LOC103690119zinc finger protein OZF-like775454907548918Rat
9238983LOC103692755polycomb group RING finger protein 2-like7355251356246Rat
9379129LOC103692757uncharacterized LOC103692757710791401096807Rat
9252969LOC103692784cytochrome P450 4F5-like71165212411665066Rat
9465708LOC103695338zinc finger protein 625-like71187990011883448Rat
9470099LOC10369490060 kDa heat shock protein, mitochondrial pseudogene71025847710260152Rat
9393801LOC103692780peptidyl-prolyl cis-trans isomerase A-like71164494111645529Rat
9854660Rps27a-ps11ribosomal protein S27a, pseudogene 11710173231017874Rat
11370628LOC108351572glyceraldehyde-3-phosphate dehydrogenase-like71212354112130723Rat
11439584LOC108351405uncharacterized LOC108351405793839079387258Rat
11371334Trnaf-gaa3transfer RNA phenylalanine (anticodon GAA) 3794602599460331Rat
11356498Olr883olfactory receptor 883717228391723774Rat
11409059LOC108351409uncharacterized LOC10835140971178100711795331Rat
11386620Trnan-guu8transfer RNA asparagine (anticodon GUU) 8794600639460136Rat
11411271LOC108351611SUMO-conjugating enzyme UBC9-B pseudogene790318459034020Rat
11390127LOC108351595uncharacterized LOC108351595776362817637924Rat
11511767LOC108351404glyceraldehyde-3-phosphate dehydrogenase pseudogene788955868897122Rat
11517013Trnas-cga1transfer RNA serine (anticodon CGA) 17881110881191Rat
41136468LOC120093771uncharacterized LOC120093771786596658663254Rat
41202999LOC120093751ribosome biogenesis regulatory protein homolog748269904863816Rat
41276916LOC120093524uncharacterized LOC1200935247511245515134Rat
41355181LOC120093948small nucleolar RNA SNORD597517080517151Rat
41355184LOC120093754uncharacterized LOC120093754764560556463156Rat
41355282LOC120093838DNA methyltransferase 1-associated protein 1-like71242679512428396Rat
41356532LOC120093980small nucleolar RNA SNORA17752362845236420Rat
41169188LOC120093773uncharacterized LOC120093773788236268826457Rat
41277984LOC120093529uncharacterized LOC120093529713544001357881Rat
41284065LOC120093983small nucleolar RNA SNORA17736055913605714Rat
41357914LOC120093949small nucleolar RNA SNORD597516291516366Rat
41207021LOC120093749olfactory receptor 6C3-like725675632568519Rat
41207417LOC120093525myosin light chain 6B7914079918598Rat
41207547LOC120093527uncharacterized LOC1200935277974825976794Rat
41281370LOC120093770uncharacterized LOC120093770785833958583961Rat
41146420LOC120093531zinc finger protein 431-like775606817563764Rat
41364644LOC120094012small nucleolar RNA SNORA2671039631110396426Rat
41364670LOC120093897U6 spliceosomal RNA7678357678463Rat
41150744LOC120094039small nucleolar RNA U3770647247064847Rat
41263396LOC120093528uncharacterized LOC120093528711285041130023Rat
41123676LOC120093836olfactory receptor 6C6-like764092426410207Rat
41180542LOC120093532uncharacterized LOC120093532797177049723275Rat
41156517LOC120094002small nucleolar RNA SNORA17729294922929600Rat
41181405LOC120093535uncharacterized LOC12009353571186875011873460Rat
41181563LOC120094051U6 spliceosomal RNA797227399722845Rat
41288666LOC12009383540S ribosomal protein S8-like734524553453090Rat
41216689LOC120093757ferritin light chain 1-like778328537833401Rat
41183995LOC120093536uncharacterized LOC12009353671223931412245244Rat
41218874LOC120093837olfactory receptor 6C76-like764513326452305Rat
41270318LOC120093756zinc finger protein 844-like774203247425637Rat
41128918LOC120093523partner of Y14 and mago-like7318237324601Rat
41161430LOC120094052U6 spliceosomal RNA797983159798421Rat
41271811LOC120093775uncharacterized LOC120093775791518269154071Rat
41293978LOC120093915U6 spliceosomal RNA71221229112212381Rat
41400406LOC120093833olfactory receptor 9714373681438306Rat
41401004LOC120093963U1 spliceosomal RNA71188257311882738Rat
41274423LOC120094041U4 spliceosomal RNA777207517720911Rat
41376983LOC120093905U6 spliceosomal RNA792368479236951Rat
41109737LOC12009375026S proteasome regulatory subunit 6B-like746809714696431Rat
41012029LOC120093984small nucleolar RNA SNORA17756279665628089Rat
40948222LOC120093997small nucleolar RNA SNORA17732648123264935Rat
40950374LOC120093530uncharacterized LOC120093530773211777327890Rat
40956712LOC12009375340S ribosomal protein S8-like763617186367763Rat
40960162LOC120093962small nucleolar RNA SNORA557880322880449Rat
40984152LOC120093964small nucleolar RNA SNORD37785362028536265Rat
40986631LOC120094030U2 spliceosomal RNA776065647606715Rat
40988644LOC120094016small nucleolar RNA SNORA797834295834439Rat
41008517LOC120093774uncharacterized LOC120093774790159519016655Rat
40943365LOC120093534uncharacterized LOC12009353471020566810209303Rat
40943841LOC120093769uncharacterized LOC120093769782974658300255Rat
41074591LOC120093526uncharacterized LOC1200935267915888928092Rat
41026461LOC120093755igE-binding protein-like766291566630636Rat
41247486LOC120093978small nucleolar RNA SNORA17728708432870974Rat
41135863LOC120093834olfactory receptor 6C74-like734504073451348Rat
41054536NEWGENE_40926764transfer RNA proline (anticodon AGG)787476338747713Rat
41317527LOC120093748ribosome biogenesis regulatory protein homolog723573912444653Rat
41034541LOC120093772uncharacterized LOC120093772786869888687890Rat
41060365LOC120093999small nucleolar RNA SNORA17762509076251027Rat
41223603LOC120093537zinc finger protein OZF-like71250539912536302Rat
41223854LOC120093113zinc finger protein OZF-like773293047338192Rat
41300297LOC120094003small nucleolar RNA SNORA17738303093830430Rat
41064546LOC12009353340S ribosomal protein S19-like71004987310050255Rat
41238955LOC120093998small nucleolar RNA SNORA17725773932577514Rat
41023869LOC120093752NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4-like755251035531648Rat
68401Gzmkgranzyme K24484081144848829Rat
619718Sv2csynaptic vesicle glycoprotein 2c22723293327428479Rat
619752Acot12acyl-CoA thioesterase 1222298686723027538Rat
2586F2rcoagulation factor II (thrombin) receptor22686934326885856Rat
2322Cdh6cadherin 626207913962225228Rat
619958Pdzd2PDZ domain containing 226138461461770516Rat
3281Pde4dphosphodiesterase 4D24001493341529190Rat
2238C6complement C625384602753921279Rat
61957Isl1ISL LIM homeobox 124807941248090704Rat
70970Hmgcs13-hydroxy-3-methylglutaryl-CoA synthase 125164936851667100Rat
70974Kif2akinesin family member 2A23836799838431237Rat
2403Crhbpcorticotropin releasing hormone binding protein22669240326704710Rat
619741Cdh10cadherin 1026862862368850995Rat
620058PolkDNA polymerase kappa22782222827882331Rat
3196Npr3natriuretic peptide receptor 326086548360933432Rat
2633Fstfollistatin24612326046130584Rat
3043Map1bmicrotubule-associated protein 1B23081726130910458Rat
619937Ccl28C-C motif chemokine ligand 2825160135451625999Rat
3387Prkaa1protein kinase AMP-activated catalytic subunit alpha 125424029854275978Rat
3407Prlrprolactin receptor25913414759324719Rat
2677Gdnfglial cell derived neurotrophic factor25689399256919935Rat
2687Ghrgrowth hormone receptor25254145252804960Rat
2923Itga1integrin subunit alpha 124664612546812237Rat
62046Thbs4thrombospondin 422398315824025289Rat
69419Ccnhcyclin H21583483315855643Rat
69413Rasgrf2RAS protein-specific guanine nucleotide-releasing factor 222311361323361537Rat
70951Glrxglutaredoxin253418735351686Rat
621007Dab2DAB adaptor protein 225551469255567476Rat
621226Golph3golgi phosphoprotein 326134803061376051Rat
621496Bhmtbetaine-homocysteine S-methyltransferase22485987124879449Rat
727842LOC252890Z39 small nucleolar RNA21684197116842030Rat
620688Hcn1hyperpolarization-activated cyclic nucleotide-gated potassium channel 124949577149899702Rat
621696Srek1splicing regulatory glutamic acid and lysine rich protein 123484955234885120Rat
621431LifrLIF receptor subunit alpha25622439356292988Rat
620249Cetn3centrin 321208902512101828Rat
2412Hapln1hyaluronan and proteoglycan link protein 122063164020696388Rat
68345Hspb3heat shock protein family B (small) member 324529528545295999Rat
621682Nr2f1nuclear receptor subfamily 2, group F, member 1280403758050123Rat
621571Serinc5serine incorporator 522384689923950346Rat
621281Naip6NLR family, apoptosis inhibitory protein 623150742331559098Rat
620760Plk2polo-like kinase 224196917641974945Rat
621832Plpp1phospholipid phosphatase 124443900244500430Rat
620450Spef2sperm flagellar 225851248958694718Rat
628640Gzmagranzyme A24474063844752471Rat
621632Itga2integrin subunit alpha 224652034546621487Rat
628725Homer1homer scaffold protein 122454277724645715Rat
2606Fgf10fibroblast growth factor 1025080189750875428Rat
727945Otporthopedia homeobox22610815826116359Rat
620923Rab3cRAB3C, member RAS oncogene family24162772041843541Rat
620453Dmgdhdimethylglycine dehydrogenase22491260024987533Rat
621582Sub1SUB1 regulator of transcription26100564661020486Rat
621587Trim23tripartite motif-containing 2323530240535335746Rat
621067Embembigin24907050949125042Rat
620966Map3k1mitogen-activated protein kinase kinase kinase 124334857243414706Rat
621729Dnajc21DnaJ heat shock protein family (Hsp40) member C2125941950559446743Rat
3156Ndufs6NADH:ubiquinone oxidoreductase subunit S622720171327202126Rat
621199Nup155nucleoporin 15525720131057252918Rat
621767Agxt2alanine-glyoxylate aminotransferase 225933625259377664Rat
727976Sgtbsmall glutamine rich tetratricopeptide repeat co-chaperone beta23523304535269527Rat
621124Cdk7cyclin-dependent kinase 723184054531865447Rat
2903Il6stinterleukin 6 cytokine family signal transducer24406597944106255Rat
2500Dhfrdihydrofolate reductase22358587623611199Rat
1305805Card6caspase recruitment domain family, member 625419434354206902Rat
621518Nlnneurolysin23513363435232927Rat
1304857Slf1SMC5-SMC6 complex localization factor 1267670156874428Rat
3048Amacralpha-methylacyl-CoA racemase25994615859958255Rat
628641Ptger4prostaglandin E receptor 425433056354347451Rat
620755Smn1survival of motor neuron 1, telomeric23149001831501065Rat
620319C9complement C925557309455621345Rat
61977Ckmt2creatine kinase, mitochondrial 222307992023110518Rat
620866F2rl1F2R like trypsin receptor 122677227426785226Rat
620871F2rl2coagulation factor II (thrombin) receptor-like 222697205426977098Rat
621039Rps23ribosomal protein S2322207933922080909Rat
1306809Nadk2NAD kinase 2, mitochondrial25811767458159815Rat
620318C7complement C725408811654165102Rat
620089Oclnoccludin23165721731707466Rat
621712Foxd1forkhead box D122970255829704978Rat
2272CartptCART prepropeptide23125509831257452Rat
735041Pde8bphosphodiesterase 8B22627511726479725Rat
1305010C1qtnf3C1q and TNF related 325991709959939519Rat
3537Rasa1RAS p21 protein activator 121585770415940757Rat
1307506Gpx8glutathione peroxidase 824467644844680042Rat
1305526Fam172afamily with sequence similarity 172, member A275538738018183Rat
2278Castcalpastatin239731124082658Rat
2803Hmgcr3-hydroxy-3-methylglutaryl-CoA reductase22799752328018983Rat
619940Vcanversican22076171820860637Rat
1306363Wdr41WD repeat domain 4122622279726273840Rat
1305799Depdc1bDEP domain containing 1B23989116339963779Rat
1306393NipblNIPBL, cohesin loading factor25739944357586770Rat
1305813Fbxl7F-box and leucine-rich repeat protein 727713977577509223Rat
1306438Tent2terminal nucleotidyltransferase 222438013524432099Rat
71013Esm1endothelial cell-specific molecule 124487606744884805Rat
621491Basp1brain abundant, membrane attached signal protein 127581613075863801Rat
727861Taf9TATA-box binding protein associated factor 923179431631798324Rat
3272Pcsk1proprotein convertase subtilisin/kexin type 1243955434442434Rat
1306592EgflamEGF-like, fibronectin type III and laminin G domains25630194556476665Rat
1307323Adamts12ADAM metallopeptidase with thrombospondin type 1 motif, 1226003287360327629Rat
2845Htr1a5-hydroxytryptamine receptor 1A23669417436695442Rat
3660Selenopselenoprotein P25249812352508409Rat
1302983Osmroncostatin M receptor25590711955961373Rat
1307580Fbxo4F-box protein 425317479853187792Rat
1307450Zcchc9zinc finger CCHC-type containing 922303815623048249Rat
1306703Mblac2metallo-beta-lactamase domain containing 221198607512028882Rat
1307607Hexbhexosaminidase subunit beta22848399728504165Rat
1307061Arhgef28Rho guanine nucleotide exchange factor 2822926388629560595Rat
1308508Brix1biogenesis of ribosomes BRX125945060859461486Rat
1308512Bdp1B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB23145752331470119Rat
708542Erap1endoplasmic reticulum aminopeptidase 1239318173970735Rat
1306583Trappc13trafficking protein particle complex subunit 1323527049335302049Rat
1306690Slc45a2solute carrier family 45, member 225996359959996408Rat
1307735Ankrd55ankyrin repeat domain 5524388387743983820Rat
1307193Myo10myosin X27610096276304164Rat
1309515Rad17RAD17 checkpoint clamp loader component23176426031794542Rat
1305984MtrexMtr4 exosome RNA helicase24450032644560624Rat
1303108Ankra2ankyrin repeat family A member 222961286729623748Rat
1305413Mroh2bmaestro heat-like repeat family member 2B25400387054063992Rat
1305199Mctp1multiple C2 and transmembrane domain containing 1260714086761833Rat
2291Ccnb1cyclin B123191219031921163Rat
3698Slc1a3solute carrier family 1 member 325775549557830605Rat
1307224RictorRPTOR independent companion of MTOR, complex 225581187755903893Rat
3625Scamp1secretory carrier membrane protein 122543395825516734Rat
1310204Ppwd1peptidylprolyl isomerase domain and WD repeat containing 123533730135360661Rat
1308095Btf3basic transcription factor 322965976429666898Rat
1309315Mrps36mitochondrial ribosomal protein S3623187054931878335Rat
1309146Zfp622zinc finger protein 62227647960576494405Rat
1309131Cert1ceramide transporter 122788254627987090Rat
1309776Il7rinterleukin 7 receptor25845239358477757Rat
3329Pik3r1phosphoinositide-3-kinase regulatory subunit 123287894232963611Rat
1310461Cenpkcentromere protein K23536013235421372Rat
1310367Snx18sorting nexin 1824523232545258345Rat
1311538Tbcatubulin folding cofactor A22601171426065909Rat
1311550Rxfp3relaxin family peptide receptor 326000325660004686Rat
1308360Triotrio Rho guanine nucleotide exchange factor27850506978801384Rat
1307626Droshadrosha ribonuclease III26186488661976688Rat
1309697Mrps30mitochondrial ribosomal protein S3025045625350463128Rat
1559647RGD1559647similar to Psmc6 protein21653532416536530Rat
1310992Utp15UTP15, small subunit processome component22959440529612819Rat
1311881Slc38a9solute carrier family 38, member 924429163744374897Rat
1311890Zfrzinc finger RNA binding protein26113761161200322Rat
2158Arsbarylsulfatase B22500221025162675Rat
1311570Ercc8ERCC excision repair 8, CSA ubiquitin ligase complex subunit23964739339686229Rat
1311752Dimt1DIM1 rRNA methyltransferase and ribosome maturation factor23834308638366760Rat
1560402RGD1560402similar to Phosphoglycerate kinase 124275460542755929Rat
1310888Aggf1angiogenic factor with G patch and FHA domains 122661933626646050Rat
1308372Tnpo1transportin 123020752930300162Rat
1310182Arskarylsulfatase family, member K255757275631370Rat
1305668Paip1poly(A) binding protein interacting protein 125152314251550241Rat
2300145Cox7ccytochrome c oxidase subunit 7C21684177116843796Rat
1306909Marveld2MARVEL domain containing 223174265231764150Rat
1310697Cwc27CWC27 spliceosome associated cyclophilin23576467435975908Rat
1308170Cd180CD180 molecule23385594033870046Rat
1305938RGD1305938similar to expressed sequence AW54987725318978753203981Rat
1305942Rai14retinoic acid induced 1425954628459682687Rat
1310560Elovl7ELOVL fatty acid elongase 723978922939858579Rat
1308793Ddx4DEAD-box helicase 424422794644282867Rat
1310081Cplane1ciliogenesis and planar polarity effector 125726919557369580Rat
1308291Spata9spermatogenesis associated 9254655735504048Rat
1305492Gpbp1GC-rich promoter binding protein 124302350443091146Rat
1306227RGD1306227similar to 4833420G17Rik protein25155322351577090Rat
1309296Ell2elongation factor for RNA polymerase II 2251893755258781Rat
1309487Wdr70WD repeat domain 7025695134557191244Rat
1307638Zfp131zinc finger protein 13125172277451753662Rat
1307559Ranbp3lRAN binding protein 3-like25805788758113158Rat
1306496Rad1RAD1 checkpoint DNA exonuclease25946159759469707Rat
1306502RGD1306502similar to hypothetical protein FLJ1119326184871661864762Rat
1309854Gfm2GTP dependent ribosome recycling factor mitochondrial 222844945228488200Rat
1306931Slc30a5solute carrier family 30 member 523194574531975969Rat
1307678Adamts6ADAM metallopeptidase with thrombospondin type 1 motif, 623542148335633305Rat
1305430Cdh18cadherin 1827281807673820144Rat
1310308Ptcd2pentatricopeptide repeat domain 223071227630739968Rat
1306624Zswim6zinc finger, SWIM-type containing 623921113139378877Rat
1306062Ttc37tetratricopeptide repeat domain 37256315445783643Rat
1310256Ap3b1adaptor related protein complex 3 subunit beta 122560006925800937Rat
1308776Capslcalcyphosine-like25839499558425527Rat
1309869Lhfpl2LHFPL tetraspan subfamily member 222528177125428128Rat
1308284RfesdRieske (Fe-S) domain containing254950675521095Rat
1310279Mccc2methylcrotonyl-CoA carboxylase subunit 223130492731375978Rat
1308343Cdh9cadherin 926628042266367121Rat
1308448Plcxd3phosphatidylinositol-specific phospholipase C, X domain containing 325356702253746384Rat
1309504Actbl2actin, beta-like 224285802042860767Rat
1309660Tmem161btransmembrane protein 161B21471445114793809Rat
1308805Lysmd3LysM domain containing 321193378711939944Rat
1305356Srek1ip1SREK1-interacting protein 123597604535999630Rat
1307902Mtmr12myotubularin related protein 1226122371461293266Rat
1309665Zbed3zinc finger, BED-type containing 322658762026600177Rat
1310139Mast4microtubule associated serine/threonine kinase family member 423389324134483600Rat
1310597Poc5POC5 centriolar protein22771974527748805Rat
1309360Rgs7bpregulator of G-protein signaling 7 binding protein23613394436231505Rat
1563891Gcnt4glucosaminyl (N-acetyl) transferase 422825331128329381Rat
1562302LOC499530hypothetical protein LOC49953024855717048566072Rat
1311241Mier3MIER family member 324328754643316422Rat
1560462RGD1560462similar to ribosomal protein L10a23719203637193479Rat
1560484RGD1560484similar to ribosomal protein L425498492954986241Rat
1564936Atp6ap1lATPase H+ transporting accessory protein 1 like22203754222079376Rat
1564928Ttc23ltetratricopeptide repeat domain 23-like25947666659538313Rat
1563920Lmbrd2LMBR1 domain containing 225818955858251565Rat
1562936RGD1562936similar to Heat shock protein HSP 90-beta (HSP 84)27212525172129162Rat
1565105Serf1small EDRK-rich factor 123147577731482030Rat
1566212RGD1566212similar to ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)22683636226836853Rat
1564606RGD1564606similar to 60S ribosomal protein L23a23845281438453384Rat
1562550Tmem267transmembrane protein 26725158021051588937Rat
1563954Msh3mutS homolog 322344432623585777Rat
1564672Shisal2bshisa like 2B23600262236019529Rat
1561129Tmem174transmembrane protein 17422999207029993601Rat
1561503Ccdc152coiled-coil domain containing 15225250798752532880Rat
1561520RGD1561520similar to Ab2-16225139226551393293Rat
1565217Ccnocyclin O24463064044633914Rat
1359591Pelopelota mRNA surveillance and ribosome rescue factor24679785346799621Rat
1565003Retreg1reticulophagy regulator 127633560976474817Rat
1560158Ndufaf2NADH:ubiquinone oxidoreductase complex assembly factor 223953568039647378Rat
1562952Erbinerbb2 interacting protein23492696235028440Rat
1564042Ttc33tetratricopeptide repeat domain 3325427990654326851Rat
1562968Ssbp2single-stranded DNA binding protein 222265048822933696Rat
1563421Fyb1FYN binding protein 125562158555781206Rat
1561161Cspg4bchondroitin sulfate proteoglycan 4B24493980745008284Rat
1561673Ccdc125coiled-coil domain containing 12523180912031835538Rat
1563766LOC499542LRRGT0017826072684860735185Rat
1359492Tmem171transmembrane protein 17123003527830045996Rat
1559914Naip5NLR family, apoptosis inhibitory protein 523155770631608722Rat
1564729Gpr150G protein-coupled receptor 150255463045550889Rat
1303152Enc1ectodermal-neural cortex 122855067028562591Rat
1311133Ipo11importin 1123816968838342929Rat
1563205OtulinlOTU deubiquitinase with linear linkage specificity like27840599478433860Rat
1359478Arrdc3arrestin domain containing 321113744311149978Rat
1310499Gtf2h2general transcription factor IIH subunit 223162375231652697Rat
1564125RGD1564125similar to Cln5 protein26589349565902741Rat
1311683Rhobtb3Rho-related BTB domain containing 3253633885419164Rat
1561110Fam151bfamily with sequence similarity 151, member B22367431723710420Rat
619925AnkhANKH inorganic pyrophosphate transport regulator27815302778280181Rat
1562101Adgrv1adhesion G protein-coupled receptor V121133143411911713Rat
1562395Spz1spermatogenic leucine zipper 122379674123798337Rat
1560001LOC499544LRRGT0015426097731561004442Rat
621335Nsa2NSA2 ribosome biogenesis factor22844314228449393Rat
1560076RGD1560076similar to 60S ribosomal protein L29 (P23)23972034939720914Rat
1359418Bhmt2betaine-homocysteine S-methyltransferase 222489552524912475Rat
1311829Mrps27mitochondrial ribosomal protein S2723074000730808577Rat
1560828Dnah5dynein, axonemal, heavy chain 527893778879255551Rat
1359573Xrcc4X-ray repair cross complementing 422094846421197705Rat
1308116Nim1kNIM1 serine/threonine protein kinase25167076451714782Rat
1562456Skp2S-phase kinase associated protein 225816122658189293Rat
1561906RGD1561906similar to RIKEN cDNA 4930430F0827298438872986671Rat
1584743LOC679799similar to Nucleophosmin (NPM) (Nucleolar phosphoprotein B23) (Numatrin) (Nucleolar protein NO38)22760092327601921Rat
1587624Atg10autophagy related 1022210930422398313Rat
1585838LOC680951similar to ubiquitin-conjugating enzyme E2 variant 123124673231247635Rat
1583002Mtx3metaxin 322406633224079708Rat
1585807LOC680982hypothetical protein LOC68098226567090865672736Rat
1583285Hspd1-ps25heat shock protein 1, pseudogene 2527460975074613329Rat
1359477Mocs2molybdenum cofactor synthesis 224650457446516327Rat
1565852LOC499541LRRGT0004526066714160673354Rat
1584008Oxct13-oxoacid CoA transferase 125323637053384715Rat
1565396Fcho2FCH and mu domain containing endocytic adaptor 223007914330181639Rat
1586478Il31rainterleukin 31 receptor A24411874844189943Rat
1587383LOC294776similar to ets variant gene 525487215354875943Rat
1587384Parp8poly (ADP-ribose) polymerase family, member 824867940548848700Rat
1582992Cmya5cardiomyopathy associated 522427952024378253Rat
1583506Cenphcentromere protein H23189425331910182Rat
1561830Fam81bfamily with sequence similarity 81, member B257506785870580Rat
1566344RGD1566344similar to eukaryotic translation elongation factor 1 alpha 125353051053547324Rat
1566350Cdh12cadherin 1227047467971705369Rat
1560883RGD1560883similar to KIAA0825 protein268744747437032Rat
1584143Cdc20bcell division cycle 20B24468834944738056Rat
1584164Mcidasmulticiliate differentiation and DNA synthesis associated cell cycle protein24463658144643730Rat
1563119Mef2cmyocyte enhancer factor 2C21397329914136065Rat
1564365Ugt3a2UDP glycosyltransferase 3 family, polypeptide A225832705858350186Rat
1562902S100zS100 calcium binding protein Z22673878026753611Rat
1559945Marchf11membrane associated ring-CH-type finger 1127689833076999690Rat
1589753LOC310177similar to RIKEN cDNA 0610040D2027601663676017401Rat
1588593LOC294635similar to spindlin isoform 221916563719166834Rat
1589594LOC502504similar to CG11883-PB, isoform B23624601036326648Rat
1564784Zfyve16zinc finger FYVE-type containing 1622371301823757576Rat
1592966LOC680363hypothetical protein LOC68036326045263060453393Rat
1593792Polr3gRNA polymerase III subunit G21194521511986125Rat
1589456Pou5f2POU domain class 5, transcription factor 2279075047908738Rat
1587346Nntnicotinamide nucleotide transhydrogenase25141141351505125Rat
1590822LOC365970similar to 2B2821122513511226004Rat
1587155LOC679528similar to peroxiredoxin 122660316726603947Rat
1586190LOC294831similar to ubiquitin-conjugating enzyme E2R 226955210069554245Rat
1590565LOC680595hypothetical protein LOC680595270368457037242Rat
1592071LOC309927similar to ribosomal protein L24263301576330588Rat
1592273LOC689489similar to DnaJ-like protein 224996595249971527Rat
1592324LOC689438similar to ribonucleic acid binding protein S124918239849183276Rat
1587804LOC685971similar to eukaryotic translation elongation factor 1 delta21678312016783583Rat
1583619LOC679871hypothetical protein LOC67987125810144858102404Rat
1587780LOC685995similar to discoidin, CUB and LCCL domain containing 121695316516959244Rat
1587831LOC685943similar to family with sequence similarity 51, member A1 homolog21659195116592611Rat
1359527Tars1threonyl-tRNA synthetase 126036825160387733Rat
1585493LOC686105similar to solute carrier family 25, member 524210259442103565Rat
1588877LOC688411similar to eukaryotic translation elongation factor 1 alpha 222062239720623912Rat
1583248LOC685054similar to solute carrier family 25, member 5282198768226468Rat
1583588LOC681102similar to synaptosomal-associated protein 23 isoform SNAP23B26760413067609584Rat
1590893Fam169afamily with sequence similarity 169, member A22838416228441361Rat
1586621GaptGrb2-binding adaptor protein, transmembrane24192753341932120Rat
1588887Edil3EGF like repeats and discoidin domains 321989039620405028Rat
1589269LOC683212similar to keratin complex 1, acidic, gene 1827891040078911742Rat
1593219LOC365713similar to 60S ribosomal protein L927660246676603113Rat
1593220LOC365709similar to SWI/SNF-related matrix-associated actin-dependent regulator of chromatin e126941461569417238Rat
1596656LOC682635similar to CG31855-PA27382393973841395Rat
1594499LOC365693similar to Nuclear protein SkiP (Ski-interacting protein) (SNW1 protein) (Nuclear receptor coactivator NCoA-62)25674032056741899Rat
1594500LOC365692similar to ribosomal protein S925658228856582972Rat
1594504LOC365673similar to microfibrillar-associated protein 124689250046893901Rat
1594505LOC365671similar to Protein CGI-11724540489145406036Rat
1594507LOC365655similar to ribosomal protein L22 like 123165479631655280Rat
1594508LOC365654similar to ATP synthase beta chain, mitochondrial precursor22913567729137702Rat
1594510LOC365650similar to metal response element binding transcription factor 222771107527712546Rat
1596482Rps8-ps1ribosomal protein S8, pseudogene 121098464010985313Rat
1594513LOC365635hypothetical LOC36563521719131017192198Rat
1595695LOC499494similar to tubulin, alpha 121190356111905006Rat
1595696LOC499487hypothetical LOC499487260077436010193Rat
1595697Rpl17-ps1ribosomal protein L17, pseudogene 1248748374875420Rat
1595422LOC681402similar to Nucleoside diphosphate kinase B (NDK B) (NDP kinase B) (P18)23347098033472009Rat
1594163LOC680268hypothetical protein LOC68026826066996860670245Rat
1596810LOC680078hypothetical protein LOC68007825831491258327069Rat
1585601Jmyjunction mediating and regulatory protein, p53 cofactor22466210424730955Rat
1590323LOC684444similar to HIStone family member (his-41)23038709430387613Rat
1595140LOC685308similar to Heat shock protein HSP 90-beta (HSP 84) (Tumor-specific transplantation 84 kDa antigen) (TSTA)27763955877641665Rat
1593816LOC685441similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI)21192000311920552Rat
1594378LOC499538similar to non-POU domain containing, octamer-binding25738143957382974Rat
1594380Ndufs4NADH:ubiquinone oxidoreductase subunit S424595132746061829Rat
1594381LOC499522similar to 60S ribosomal protein L17 (L23) (Amino acid starvation-induced protein) (ASI)23692858836929161Rat
1594382LOC499517hypothetical LOC49951723098056430981584Rat
1594383Ankrd34bankyrin repeat domain 34B22365108323668041Rat
1594384LOC499500similar to transcriptional adaptor 3-like21570446215705839Rat
1596458Tdg-ps1thymine-DNA glycosylase, pseudogene 121106041111064568Rat
1594512LOC365643hypothetical LOC36564322381914923820836Rat
1595053LOC685395hypothetical protein LOC68539527886883578869411Rat
1595064Rnf180ring finger protein 18023633028536511168Rat
1597407Arl15ADP-ribosylation factor like GTPase 1524543822145822562Rat
1596440LOC685256similar to small nuclear ribonucleoparticle-associated protein22541765525418541Rat
2318781LOC100362101hypothetical LOC10036210124331935943322764Rat
2318290LOC100362397ubiquitin-conjugating enzyme E2L 3-like27644003676441113Rat
2319559Rps15al4ribosomal protein S15A-like 425443754454438039Rat
2318361Dhx29DExH-box helicase 2924456065344611450Rat
2320545LOC100361218zinc finger and BTB domain containing 26-like21738010717440459Rat
2322829LOC100363518hypothetical LOC10036351825290706352909893Rat
2320700LOC100361161bolA-like 1-like23172813531729259Rat
2322904Zfp366zinc finger protein 36623057855230640546Rat
2322932LOC100360013ubiquitin-associated protein 226600754266009900Rat
2320812LOC100364548hypothetical LOC10036454823009310330100126Rat
2321734Iqgap2IQ motif containing GTPase activating protein 222689483627170270Rat
2323229LOC100363314hypothetical protein LOC10036331425175256851765798Rat
2322653LOC100360196SNRPN upstream reading frame22541723325417480Rat
2321913LOC100360544fibrillarin-like21248019912571223Rat
2323318Tmem167atransmembrane protein 167A22119772821216746Rat
2323466LOC100359774hypothetical LOC10035977426393638763937165Rat
2323519LOC100359721hypothetical LOC10035972126359223363595295Rat
2323520Ankrd31ankyrin repeat domain 3122807918728241722Rat
2323540LOC100359700eukaryotic translation initiation factor 1-like24539105545392369Rat
2324334LOC100362624biliverdin reductase A-like24553851845540448Rat
4888542Mir3597-2microRNA 3597-221419771114197828Rat
4888547Mir449cmicroRNA 449c24466917944669277Rat
2324500OtulinOTU deubiquitinase with linear linkage specificity27829043778316633Rat
2325413Mir582microRNA 58224092857140928651Rat
2323951LOC100362827high-mobility group nucleosomal binding domain 2-like25761869057618983Rat
2325536Mir449amicroRNA 449a24467071444670804Rat
2325602Mir9-2microRNA 9-221419772414197810Rat
2324086LOC100362772ribosomal protein S12-like25761507957615691Rat
2324713LOC100363177ferritin light chain 1-like26154356361544581Rat
2324600Smim15small integral membrane protein 1523952825639533416Rat
2325067Ankdd1bankyrin repeat and death domain containing 1B22775030127814291Rat
6488109LOC100912266uncharacterized LOC10091226622655406226563136Rat
6492359LOC100911520killer cell lectin-like receptor 5-like26421267264217862Rat
6494071LOC100911298heterogeneous nuclear ribonucleoprotein M-like27649878076500974Rat
6490176LOC10091188360S ribosomal protein L6-like286091558611368Rat
6495770LOC100911004heterogeneous nuclear ribonucleoprotein A1-like25729338457298637Rat
6499419LOC100910216casein kinase I isoform alpha-like21934243119343443Rat
6502717LOC10090962560S acidic ribosomal protein P0-like21447911014479737Rat
6504200LOC100909396uncharacterized LOC10090939626182809661830209Rat
7497054LOC102546726uncharacterized LOC10254672623355267833777029Rat
7497849LOC102548571uncharacterized LOC10254857125245354252486117Rat
7387335Ak6adenylate kinase 623179431631806375Rat
7523639LOC102554929uncharacterized LOC10255492927510102975109556Rat
7525791LOC102555062uncharacterized LOC10255506221594866515969617Rat
7505570LOC102551027uncharacterized LOC10255102722895496928999400Rat
7505957LOC102553625uncharacterized LOC10255362526877889068939928Rat
7496117LOC10254886060S ribosomal protein L19-like21258207912590457Rat
7509688LOC102548021protein FAM98B-like280008068013311Rat
7532700LOC102548988uncharacterized LOC102548988251653675190944Rat
7534134LOC102550255uncharacterized LOC10255025525516220155180537Rat
7512922LOC102556362uncharacterized LOC10255636225159536651601133Rat
7503607LOC10254829539S ribosomal protein L40, mitochondrial-like25946985759471850Rat
7517146LOC102546512uncharacterized LOC10254651223852728838537176Rat
7539922LOC102551194uncharacterized LOC10255119421661379816615809Rat
7503935LOC10255077060S ribosomal protein L21-like25602493656025455Rat
7662910LOC102552232uncharacterized LOC10255223226576716665819676Rat
7662935LOC102553734uncharacterized LOC10255373426898029469020038Rat
7613080LOC102551263uncharacterized LOC10255126322909986529102988Rat
7613395LOC102555263uncharacterized LOC10255526323210901732216220Rat
7635624LOC102553770uncharacterized LOC10255377023106828531106257Rat
7637192LOC102551224heterogeneous nuclear ribonucleoprotein R-like24433760744340578Rat
7637193LOC10255257060S ribosomal protein L29-like24747080547471791Rat
7652976LOC102554243uncharacterized LOC10255424321456843714572006Rat
7638416LOC102550768uncharacterized LOC10255076822879516728849077Rat
7654966LOC102553545uncharacterized LOC10255354523091063030933322Rat
7655727LOC102554147uncharacterized LOC10255414727215668172198344Rat
7627562LOC102557393uncharacterized LOC10255739323174211431746654Rat
7659767LOC102548697uncharacterized LOC102548697243827964396519Rat
7643568LOC102547847uncharacterized LOC10254784725206884452075436Rat
7645336LOC102549789uncharacterized LOC102549789280530298304831Rat
7588235LOC10254651060S ribosomal protein L17-like269145116918987Rat
7570025LOC102548637uncharacterized LOC10254863725280511752812142Rat
7571143LOC102551152uncharacterized LOC10255115222907398029084474Rat
7594124LOC102548635uncharacterized LOC102548635239245273931665Rat
7572801LOC102548141uncharacterized LOC10254814122476423824771284Rat
7557368LOC102556643uncharacterized LOC10255664325192915351940031Rat
7599584LOC102554363uncharacterized LOC10255436321532684715337972Rat
7606174LOC102554307uncharacterized LOC10255430724364744143693619Rat
7566528LOC102555137AT-rich interactive domain-containing protein 4A-like21597062615973408Rat
7567660LOC102547360uncharacterized LOC10254736025163178951640783Rat
7567902LOC102549347uncharacterized LOC10254934723950006339528170Rat
7554204LOC102549076glutathione S-transferase kappa 1-like252685755270357Rat
41054385LOC120101168U6 spliceosomal RNA26108224061082346Rat
7691404LOC102557105MLV-related proviral Env polyprotein-like24903190549036174Rat
7736543LOC102554057uncharacterized LOC10255405724349634343504404Rat
7751753LOC102546727uncharacterized LOC10254672723897359938994374Rat
7672686LOC102548891AKT-interacting protein-like23505758135059009Rat
7695496LOC102556361uncharacterized LOC10255636123761814037642341Rat
7676687LOC102546725uncharacterized LOC10254672523004768530053470Rat
7705669LOC102553998stathmin-like21467558414683994Rat
7683682LOC102553935uncharacterized LOC10255393524342026843436706Rat
7724377LOC102554146septin-7-like25393384753941923Rat
7716052LOC102548698uncharacterized LOC10254869822655721926579051Rat
7667725LOC102554526heterogeneous nuclear ribonucleoprotein A3-like27324733073249760Rat
7668930LOC102556051uncharacterized LOC10255605123253577832855354Rat
7700687LOC102548142uncharacterized LOC10254814225217956352183483Rat
7722382LOC102548480low molecular weight phosphotyrosine protein phosphatase-like21001410310014541Rat
7679991LOC102554085chromobox protein homolog 3-like22818840428189044Rat
7680557LOC102554306uncharacterized LOC10255430621483017614840060Rat
7710292LOC102552429uncharacterized LOC10255242921391630013972744Rat
9087824LOC103691411uncharacterized LOC10369141121379350613882765Rat
9137253LOC103691419uncharacterized LOC10369141922281453422818085Rat
9137783LOC103691475uncharacterized LOC10369147525438126754427711Rat
9179183LOC10369508940S ribosomal protein S13 pseudogene22923873429239646Rat
9150057LOC103691449uncharacterized LOC10369144923913897439167216Rat
9151583LOC103691446uncharacterized LOC10369144623719043137463186Rat
9106115LOC10369142560S ribosomal protein L7a pseudogene21326822913268696Rat
9191663LOC103691443uncharacterized LOC10369144323344482133447613Rat
9193186LOC103691468uncharacterized LOC10369146825196693351972303Rat
9200405LOC103691481uncharacterized LOC10369148125770176757704913Rat
9201190LOC103691453activated RNA polymerase II transcriptional coactivator p15 pseudogene24329894943300263Rat
9208714LOC103691456uncharacterized LOC10369145624389251943954354Rat
9307820LOC103691422uncharacterized LOC10369142222446878724481554Rat
9353912LOC103691494annexin-2 receptor-like25186121051861735Rat
9225015LOC103694538uncharacterized LOC10369453821735981217380100Rat
9314470LOC10369142360S ribosomal protein L36 pseudogene22488384524884266Rat
9243561LOC103691473V-type proton ATPase subunit e 1 pseudogene25285185152852085Rat
9387191LOC103691483uncharacterized LOC10369148325973429159747359Rat
9334188LOC103691402uncharacterized LOC103691402251088075115328Rat
9362373LOC103695100uncharacterized LOC10369510026207365762085399Rat
9362811LOC103691412uncharacterized LOC10369141221409777814109233Rat
9428698LOC103691472uncharacterized LOC10369147225251723252536035Rat
9429209LOC103691486uncharacterized LOC10369148627481148974842763Rat
9469491LOC103691462serine/arginine-rich splicing factor 3 pseudogene24412959044130630Rat
9436047LOC103691451uncharacterized LOC10369145124272675242733899Rat
9476424LOC103691460putative 60S ribosomal protein L39-like 524747242447472576Rat
9411836LOC103691459uncharacterized LOC10369145924630205646347633Rat
9453411LOC103691452uncharacterized LOC10369145224283068542950401Rat
10043200Rps27a-ps29ribosomal protein S27a, pseudogene 2921338964113390087Rat
11364647LOC108350152centromere protein R-like252412895246557Rat
11359058LOC10834996760S ribosomal protein L7a pseudogene27636625476367092Rat
11449327LOC108349941uncharacterized LOC10834994123877523038811284Rat
11474944LOC108349945uncharacterized LOC10834994524526939345274138Rat
11474953LOC10835016760S ribosomal protein L17 pseudogene24753795647538570Rat
11458063LOC108350222uncharacterized LOC10835022222409945324103141Rat
11445903LOC108350231uncharacterized LOC10835023127481003074811049Rat
11367373LOC108350221histone H2A.Z pseudogene21669623316696586Rat
11356949LOC10835015540S ribosomal protein S6 pseudogene25664481656655429Rat
11451820LOC108349943uncharacterized LOC10834994324158493541590024Rat
11371833LOC10834994960S ribosomal protein L15 pseudogene25151420551515270Rat
11452971LOC108349942uncharacterized LOC10834994223903661239069876Rat
11453461LOC108350230glyceraldehyde-3-phosphate dehydrogenase pseudogene26273716662738204Rat
11413279LOC108349939uncharacterized LOC10834993923861681938657106Rat
11418901LOC10834997060S ribosomal protein L27 pseudogene27895282078953229Rat
11419093LOC108350211uncharacterized LOC10835021123984997239855243Rat
11423879LOC108350223uncharacterized LOC10835022322611811926123605Rat
11426534LOC10834991660S ribosomal protein L7a pseudogene21441693714417836Rat
11374184LOC108349924NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 7 pseudogene22838740428399084Rat
11374962LOC108349922uncharacterized LOC10834992222590716025922806Rat
11375591LOC10835015340S ribosomal protein S6 pseudogene22114137121151233Rat
11386721LOC108350173charged multivesicular body protein 5 pseudogene27598867576005457Rat
11387679LOC108349948uncharacterized LOC10834994824793105447941984Rat
11388086LOC10834995960S ribosomal protein L23-like25753907957542026Rat
11378089LOC108350169glyceraldehyde-3-phosphate dehydrogenase-like25309889553100054Rat
11378090LOC10835022960S ribosomal protein L17 pseudogene25984172659842316Rat
11388888LOC108349921uncharacterized LOC10834992122418322224209061Rat
11402434LOC108349917uncharacterized LOC10834991721451189214552563Rat
11380414LOC108349915uncharacterized LOC10834991521327087513302846Rat
11390954LOC108350224uncharacterized LOC10835022423313033033134546Rat
11403233LOC108349968uncharacterized LOC10834996827632408476333964Rat
11381588LOC108349935uncharacterized LOC10834993523384297833850878Rat
11382166LOC108349962uncharacterized LOC10834996225783544257840143Rat
11382661LOC108349957uncharacterized LOC10834995725631680056349595Rat
11503988LOC108349927uncharacterized LOC10834992723002970630033330Rat
11506640LOC108349914uncharacterized LOC10834991421215497012204382Rat
11511747LOC108350170glyceraldehyde-3-phosphate dehydrogenase pseudogene26084791860848940Rat
11487276LOC108350210uncharacterized LOC10835021024102007441032958Rat
11493630LOC10835017160S ribosomal protein L7a pseudogene26242432862430752Rat
11494182LOC10834993260S ribosomal protein L21 pseudogene23252930632531079Rat
41111255LOC120100737E3 SUMO-protein ligase KIAA1586-like25853208058540473Rat
41137062LOC120101105U2 spliceosomal RNA27770271777702836Rat
41167126LOC120100700uncharacterized LOC12010070023939181139400380Rat
41235092LOC120100733uncharacterized LOC12010073325562890155632966Rat
41276753LOC120100740uncharacterized LOC12010074025960122159605292Rat
41381356LOC120093165uncharacterized LOC12009316525202302952027944Rat
41087919LOC120101241small nucleolar RNA SNORA2422509833125098459Rat
41088779LOC120101163U6 spliceosomal RNA282619198262025Rat
41113370LOC120101138U6 spliceosomal RNA23552861635528722Rat
41168070LOC120101349small nucleolar RNA SNORA1724997342749973549Rat
41168552NEWGENE_6576114transfer RNA threonine (anticodon AGU)24599777145997843Rat
41204573LOC120100702uncharacterized LOC12010070223949465539499673Rat
41250842LOC120100745uncharacterized LOC12010074526853932368628612Rat
41284150LOC120101361small nucleolar RNA SNORA4022927320929273341Rat
41323823LOC120101184U6 spliceosomal RNA277724527772555Rat
41324318LOC120100741uncharacterized LOC12010074126001648260032748Rat
41357925LOC12010099860S ribosomal protein L6-like26813098468132284Rat
41089898LOC120100646ubiquitin-conjugating enzyme E2 variant 1-like231881693190404Rat
41113966LOC120101286small nucleolar RNA SNORA17254561165456247Rat
41141093LOC120100722uncharacterized LOC12010072225187453551883271Rat
41141624LOC120100651uncharacterized LOC120100651280178818035957Rat
41170998LOC120100680uncharacterized LOC12010068022978892429842718Rat
41251155LOC12010063960S ribosomal protein L7a-like23201909732019924Rat
41279240LOC120100703uncharacterized LOC12010070324305524743055771Rat
41325769LOC120101262small nucleolar RNA SNORA4823344337933443518Rat
41358011LOC120100987heterogeneous nuclear ribonucleoprotein A1-like25016131450162965Rat
41384167LOC120100561ubiquitin-conjugating enzyme E2 N-like26977182569772236Rat
41090942LOC120100755uncharacterized LOC12010075527818296378184031Rat
41115917LOC120100658uncharacterized LOC12010065821343900513528948Rat
41172051LOC120100725uncharacterized LOC12010072525197693651989635Rat
41172133LOC120101204U6 spliceosomal RNA22984966929849772Rat
41206868LOC120100999glyceraldehyde-3-phosphate dehydrogenase-like27533303175333975Rat
41207236LOC120100736uncharacterized LOC12010073625810997758118986Rat
41207854LOC120101081uncharacterized LOC12010108124106008041067591Rat
41253562LOC120100713uncharacterized LOC12010071324538796445393370Rat
41253697LOC120100554uncharacterized LOC12010055422990222129907787Rat
41287396NEWGENE_40933816transfer RNA valine (anticodon AAC)27284242772842507Rat
41326689LOC120100662uncharacterized LOC12010066221530437215326712Rat
41117892LOC120101248small nucleolar RNA SNORA4424661684846616952Rat
41118210LOC120100653uncharacterized LOC12010065321124605711288544Rat
41173629LOC120100749uncharacterized LOC12010074927631401276334295Rat
41328657LOC120101363small nucleolar RNA SNORD7225421716054217239Rat
41361600LOC120100654ribosome-recycling factor, mitochondrial-like21168969211690540Rat
41093744LOC120100752uncharacterized LOC12010075227726901677284684Rat
41175335LOC120101191U6 spliceosomal RNA21372052213720616Rat
41210646LOC120100677uncharacterized LOC12010067722873301528741444Rat
41261285LOC120101395U1 spliceosomal RNA27406126874061423Rat
41330271LOC120100660uncharacterized LOC12010066021459565214715634Rat
41389417LOC120100661uncharacterized LOC12010066121526485415280304Rat
41364365LOC120100543ubiquitin-conjugating enzyme E2 variant 1-like232422943242740Rat
41391875LOC120100655ubiquitin-conjugating enzyme E2 L3-like21163469611636749Rat
41122070LOC120101373small nucleolar RNA SNORA4722659426026594397Rat
41151137LOC120100552uncharacterized LOC12010055222717960227186615Rat
41178063LOC12010056360S ribosomal protein L7a-like27551842375523313Rat
41178470LOC120100559uncharacterized LOC12010055925877866258796834Rat
41190503LOC120100693uncharacterized LOC12010069323367858233734740Rat
41213139LOC120100718uncharacterized LOC12010071824648879546493298Rat
41213451LOC120101199U6 splice