D7Got114 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D7Got114

Symbol: D7Got114
Previously known as: OT68.08; oxsts2381; 
RGD ID: 44338
Expected Size: 199 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.27126,097,126 - 126,097,325 (+)MAPPERmRatBN7.2
Rnor_6.07136,279,092 - 136,279,290NCBIRnor6.0
Rnor_5.07135,924,703 - 135,924,901UniSTSRnor5.0
RGSC_v3.47133,502,356 - 133,502,555RGDRGSC3.4
RGSC_v3.47133,502,357 - 133,502,555UniSTSRGSC3.4
RGSC_v3.17133,578,794 - 133,578,992RGD
Celera7122,477,279 - 122,477,477UniSTS
RH 3.4 Map71023.3UniSTS
RH 3.4 Map71023.3RGD
RH 2.0 Map7756.1RGD
Cytogenetic Map7q35UniSTS
Is Marker For: Genes:   Tmem117  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. UniSTS Pipeline RGD automated pipelines
4. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
5. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCATGGGGTCCTTCACATAT
Reverse Primer CCTCCTTGAGCCCTTTGTTCT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1562562Tmem117transmembrane protein 1177125757591126219692Rat

Nucleotide Sequences
GenBank Nucleotide AU027756 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300179Kidm5Kidney mass QTL 53.51kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)743747012135012528Rat
70173Niddm19Non-insulin dependent diabetes mellitus QTL 194.330.00005blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)764002457135012528Rat
634331Pia17Pristane induced arthritis QTL 174.7joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)773829340130221005Rat
2317052Aia17Adjuvant induced arthritis QTL 172.13joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)781737938126737938Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)783153392128153392Rat
1358891Bp265Blood pressure QTL 2652.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
1358914Bp266Blood pressure QTL 266arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)783591953134666232Rat
71114Niddm14Non-insulin dependent diabetes mellitus QTL 144.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)784257275129257275Rat
2298475Eau6Experimental allergic uveoretinitis QTL 60.0029uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)784257275129257275Rat
1558655Swd4Spike wave discharge measurement QTL 43.680.0002brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge severity grade (CMO:0001988)786983365131983365Rat
1549899Stresp8Stress response QTL 84.370.0008stress-related behavior trait (VT:0010451)defensive burying duration (CMO:0001961)790482196135012528Rat
2299163Iddm34Insulin dependent diabetes mellitus QTL 342.71blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)791281130135012528Rat
631687Hcas1Hepatocarcinoma susceptibility QTL 13.90.001liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)791412594129807172Rat
731176Glom5Glomerulus QTL 52.50.0035kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)796670164135012528Rat
1331731Bp216Blood pressure QTL 2162.851arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7102297359133492884Rat
731174Uae23Urinary albumin excretion QTL 232.40.0042urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)7104603555135012528Rat
2306821Bp335Blood pressure QTL 3350.001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7106571501135012528Rat
631663Bw6Body weight QTL 63.4body mass (VT:0001259)body weight (CMO:0000012)7111075573134976056Rat
1300112Bp183Blood pressure QTL 1833.51arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)7111182207135012528Rat
1331748Bp215Blood pressure QTL 2154.043arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)7112308254133492884Rat
1357339Stl14Serum triglyceride level QTL 143.450.0001blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7112729683133492707Rat
631201Panci1Pancreas inflammation QTL 100.001pancreas integrity trait (VT:0010560)percentage of study population displaying chronic pancreatitis at a point in time (CMO:0001214)7116677189127103496Rat
1354582Stl11Serum triglyceride level QTL 113.42blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)7119513385135012528Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 500921 UniSTS
UniSTS 112996 UniSTS