DXWox3 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXWox3

Symbol: DXWox3
Also known as: R258; MSBX201; oxsts5778; 
RGD ID: 43947
Expected Size: 130 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.2X120,568,566 - 120,568,734 (+)MAPPERmRatBN7.2
Rnor_6.0X127,888,048 - 127,888,215NCBIRnor6.0
Rnor_5.0X127,982,894 - 127,983,061UniSTSRnor5.0
CeleraX119,694,765 - 119,694,932UniSTS
RH 3.4 Map5716.9RGD
RH 3.4 Map5716.9UniSTS
RH 2.0 Map5727.5RGD
Cytogenetic MapX RGD
Is Marker For: QTLs:   Cia18   Cia19  
Genes:   LOC678717   LOC100365051  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GATCGTCCAGCATCGTGG
Reverse Primer GTTGGTGCTACTCAAGATCGG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1596967LOC678717similar to eukaryotic translation initiation factor 3, subunit 12X127887444127888079Rat

Nucleotide Sequences
GenBank Nucleotide CH473991 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X15688119127888215Rat
1598837Memor13Memory QTL 133.2exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X44320616158345622Rat
61431Cia19Collagen induced arthritis QTL 194.4joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X70352120127888215Rat
724551Glom1Glomerulus QTL 12.80.0004kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)X82930791127930791Rat
1598872Memor14Memory QTL 144.5exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X101333032146333032Rat
738025Stresp3Stress response QTL 34.610.0066stress-related behavior trait (VT:0010451)defensive burying - approachX107886746152409805Rat
1598809Memor15Memory QTL 154.4exploratory behavior trait (VT:0010471)difference between time of physical contact/close proximity of test subject and social stimulus during sample phase and test phase (CMO:0002678)X110957467155957467Rat
1598856Memor1Memory QTL 11.9exploratory behavior trait (VT:0010471)total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)X110957467155957467Rat
10059603Bw174Body weight QTL 1743.40.025body mass (VT:0001259)body weight (CMO:0000012)X118715462159970021Rat
738029Stresp2Stress response QTL 23.40.0004stress-related behavior trait (VT:0010451)defensive burying - approachX120045041143145818Rat
5685004Bss104Bone structure and strength QTL 1043.9tibia area (VT:1000281)tibia area measurement (CMO:0001382)X121442246134627946Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100365051 UniSTS
  326438 UniSTS
  326439 UniSTS
  678717 UniSTS
UniSTS 119285 UniSTS