D15Got96 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D15Got96

Symbol: D15Got96
Also known as: OT93.27; oxsts1199; 
RGD ID: 43400
Expected Size: 132 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01597,178,339 - 97,178,470NCBIRnor6.0
Rnor_5.015100,654,854 - 100,654,985UniSTSRnor5.0
RGSC_v3.41596,848,859 - 96,848,990UniSTSRGSC3.4
RGSC_v3.41596,848,858 - 96,848,990RGDRGSC3.4
RGSC_v3.11596,864,639 - 96,864,770RGD
Celera1588,203,459 - 88,203,588UniSTS
RH 3.4 Map11562.51RGD
RH 3.4 Map11562.51UniSTS
RH 2.0 Map11150.6RGD


Annotation



Strains and Sequence

Sequence
 
Forward Primer TCTTATCACAATCACTGGAAATGAG
Reverse Primer AGTAAGCAGCAACTGGAGGG
 

Region



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1578646Bmd18Bone mineral density QTL 185.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)1526381041106550657Rat
1578647Bmd17Bone mineral density QTL 174femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)1526381041106550657Rat
1578660Bss19Bone structure and strength QTL 194.3femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)1526381041106550657Rat
1300144Rf23Renal function QTL 233.61renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1543097470106550657Rat
1576315Schws6Schwannoma susceptibility QTL 60.0069nervous system integrity trait (VT:0010566)post-insult time of death (CMO:0002005)1561447766106447766Rat
61477Aia4Adjuvant induced arthritis QTL 43joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)156259641099372139Rat
631516Gluco31Glucose level QTL 317blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1562596410103164962Rat
631655Bp126Blood pressure QTL 1264arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1565520564110520564Rat
731177Uae26Urinary albumin excretion QTL 262.40.025urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1575527634111246239Rat
2300326Plaw1Placental weight QTL 1150.005placenta mass (VT:0004257)placenta wet weight (CMO:0002088)1575761024109400896Rat
1331724Bp223Blood pressure QTL 2233.53715arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1581255292103165069Rat
1641889Colcr6Colorectal carcinoma resistance QTL 62.90.0126intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)1581255292109133904Rat
70182BpQTLcluster12Blood pressure QTL cluster 123.53arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)1581255430103164962Rat
1581555Eae19Experimental allergic encephalomyelitis QTL 194.7nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis severity score (CMO:0001419)158394771498027710Rat
70155Gcs1Gastric cancer susceptibility QTL13.8stomach morphology trait (VT:0000470)stomach tumor susceptibility score (CMO:0002043)1583947714111246239Rat
1549844Bss7Bone structure and strength QTL 76.4femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)1584050550111246239Rat
2317055Aia10Adjuvant induced arthritis QTL 103.41joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)1584050550111246239Rat
1300118Bp190Blood pressure QTL 1902.94arterial blood pressure trait (VT:2000000)blood pressure measurement (CMO:0000003)1589640684106550657Rat
1300120Kidm7Kidney mass QTL 73.55kidney mass (VT:0002707)left kidney wet weight to body weight ratio (CMO:0001954)1589640684106550657Rat
1581519Cm59Cardiac mass QTL 592.80.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)1596777066104003672Rat


Additional Information

Database Acc Id Source(s)
UniSTS 114556 UniSTS