D5Rat245 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D5Rat245

Symbol: D5Rat245
Previously known as: oxsts11132; R0311-D04; 
RGD ID: 42770
Expected Size: 145 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RH 3.4 Map51135.5UniSTS
RH 3.4 Map51135.5RGD
RH 2.0 Map51119.2RGD
SHRSP x BN Map599.3999RGD
Is Marker For: Strains:   WKY.WKHA-(D5Rat45-D5Rat245)/Cfd  
QTLs:   Lanf1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer CCACTCTGTGTTTTTAAAACTGGA
Reverse Primer CCTCCCTGGAGAAAACATTT
 

Region

Nucleotide Sequences


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303039 UniSTS
  369061 UniSTS