D1Rat414 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D1Rat414

Symbol: D1Rat414
Also known as: R0313-A01; oxsts10277; 
RGD ID: 42481
Expected Size: 207 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01100,691,414 - 100,691,615NCBIRnor6.0
Rnor_6.0199,430,284 - 99,430,485NCBIRnor6.0
Rnor_5.01101,757,393 - 101,757,594UniSTSRnor5.0
Rnor_5.01100,502,313 - 100,502,514UniSTSRnor5.0
RGSC_v3.4195,166,789 - 95,166,990UniSTSRGSC3.4
RGSC_v3.4195,166,788 - 95,166,989RGDRGSC3.4
RGSC_v3.1195,244,899 - 95,245,100RGD
Celera189,441,154 - 89,441,355UniSTS
SHRSP x BN Map147.9099RGD
SHRSP x BN Map147.9099UniSTS


Annotation



Strains and Sequence

Sequence
 
Forward Primer AAGACCCTGAAGTGTCTGGG
Reverse Primer TGGTGTTTGCTATGGGACTG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3627Clec11aC-type lectin domain containing 11A1100290374100293515Rat
61906Nr1h2nuclear receptor subfamily 1, group H, member 21100554577100559896Rat
3888Klk1c2kallikrein 1-related peptidase C219998104599985422Rat
2969Klk1kallikrein 11100131562100135556Rat
3175Klk1b3kallikrein 1-related peptidase B31100199057100203260Rat
61940Napsanapsin A aspartic peptidase1100577497100589802Rat
621358Kcnc3potassium voltage-gated channel subfamily C member 31100593453100607874Rat
3419Klk6kallikrein related-peptidase 619976219599769486Rat
621011Shank1SH3 and multiple ankyrin repeat domains 11100297137100344377Rat
1303214Emc10ER membrane protein complex subunit 101100495112100501468Rat
1303220Klk1c6kallikrein 1-related peptidase C619994771499964824Rat
1303242Klk10kallikrein related-peptidase 1019971827599722743Rat
727805Klk1c9kallikrein 1-related peptidase C91100086520100090406Rat
1306821Myh14myosin heavy chain 141100608975100671086Rat
621839Pold1DNA polymerase delta 1, catalytic subunit1100538066100554105Rat
735032Klk1c3kallikrein 1-related peptidase C31100141205100163945Rat
1306420Klk7kallikrein-related peptidase 719974999199754723Rat
1305998Klk8kallikrein related-peptidase 819973516899742011Rat
1307121Lrrc4bleucine rich repeat containing 4B1100434418100468914Rat
1303228Klk4kallikrein-related peptidase 419982894499834642Rat
1311142Fam71e1family with sequence similarity 71, member E11100501556100507334Rat
1309036RGD1309036hypothetical LOC2928741100346096100361340Rat
1308606Klk14kallikrein related-peptidase 1419961615399621425Rat
1308280Klk9kallikrein related-peptidase 919972970499733996Rat
1308975Klk12kallikrein related-peptidase 1219970614899711004Rat
1308690Klk11kallikrein related-peptidase 1119971210499716648Rat
1310111Aspdhaspartate dehydrogenase domain containing1100471066100473327Rat
1307305Josd2Josephin domain containing 21100473426100477352Rat
1308740Ctu1cytosolic thiouridylase subunit 119959960899605412Rat
1309326Fv1Friend virus susceptibility 11100220789100226725Rat
1309337Klk13kallikrein related-peptidase 1319964865899661025Rat
1308270Acp4acid phosphatase 41100226311100234536Rat
1309564Zfp819zinc finger protein 81919952117799539232Rat
1563905RGD1563905similar to ribosomal protein L191100675818100676522Rat
1561403Klk1c10kallikrein 1-related peptidase C1019989029499894353Rat
1565899SpibSpi-B transcription factor1100531538100537397Rat
1563539Ceacam18CEA cell adhesion molecule 1819955972699576098Rat
1311596Mybpc2myosin binding protein C21100506704100530201Rat
1563073Siglec8sialic acid binding Ig-like lectin 819957694699587441Rat
3805Syt3synaptotagmin 31100379236100407862Rat
1593461Klk5kallikrein related-peptidase 519978129199793745Rat
1593397LOC690674similar to kallikrein 1519998816999994965Rat
1592234LOC690730similar to kallikrein 151100120971100129708Rat
1596223LOC687880similar to Kallikrein-1 precursor (Tissue kallikrein) (Kidney/pancreas/salivary gland kallikrein)19986600699887449Rat
1598667Klk5lkallikrein 5-like1100055956100058334Rat
2323541LOC100363199kallikrein 1-like1100140158100141517Rat
6489953LOC100911976izumo sperm-egg fusion protein 2-like19944755599460196Rat
6485832LOC100912774kallikrein-15-like1100023555100035063Rat
6500871LOC100909904uncharacterized LOC1009099041100487645100490470Rat
7541917LOC102546648uncharacterized LOC10254664819948317699496427Rat
7510716LOC102556967zinc finger protein 484-like19950021199513269Rat
7612505LOC102552286formyl peptide receptor-related sequence 4-like1100238571100239605Rat
7636386LOC102552731uncharacterized LOC1025527311100203571100220722Rat
7655709LOC102553035kallikrein-15-like1100187830100196494Rat
7557829LOC102549343kallikrein-15-like1100077181100083494Rat
7690508LOC102546987kallikrein-2-like19995827199977635Rat
7731725LOC102552485uncharacterized LOC1025524851100209780100217634Rat
7740120LOC102549238kallikrein-15-like1100061530100070233Rat
7667275LOC102546874prostate-specific antigen-like19991975599947079Rat
9176004LOC103690048prostatic glandular kallikrein-6-like1100037033100040907Rat
9147613LOC103691132kallikrein-15-like1100156308100157688Rat
9202400LOC103691107NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4 pseudogene19963240399632869Rat
9170070LOC103691133prostate-specific antigen-like1100171894100175693Rat
9348765LOC103691128kallikrein-15-like19996720299972117Rat
9231922LOC103691106zinc finger protein 175-like19955238199553788Rat
9278208LOC103691110uncharacterized LOC1036911101100295067100297841Rat
9325291LOC103691108uncharacterized LOC10369110819991461399917510Rat
9369268LOC103689933glandular kallikrein-3, submandibular1100160127100163941Rat
9421087LOC103691109uncharacterized LOC1036911091100234593100236057Rat
11460610LOC108348116glandular kallikrein-3, submandibular-like1100164325100165474Rat
11388338LOC108349570uncharacterized LOC1083495701100427869100434306Rat
11400164LOC108349762kallikrein-1E2-like1100141103100144082Rat
11379690LOC108349569uncharacterized LOC1083495691100165798100167024Rat
11496573Gpr32G protein-coupled receptor 321100246794100247826Rat

Nucleotide Sequences
GenBank Nucleotide JH612604 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15655769122614963Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)123406428108057505Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)125951907130917265Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)134993530173445086Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)135377692217372257Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143579208126240667Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143579208126240667Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143579208126240667Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143579208126240667Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143579208126240667Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)143579208126240667Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143579208126240667Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)149147799156446783Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149578577169852184Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149578693217054291Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)157761301104391981Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)158209327103209327Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)158354072161711996Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)164588516125875986Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)166113339122614963Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)179134941113593716Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)179689548124689548Rat
1578780Cm52Cardiac mass QTL 523.30.0001heart mass (VT:0007028)heart wet weight (CMO:0000069)182788437239853971Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)183502376128502376Rat
2313083Bmd74Bone mineral density QTL 7440.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)183656882126240667Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)185779320130779320Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)185917265130917265Rat
4889494Scort2Serum corticosterone level QTL 24.2blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)186776571131776571Rat
2300324Fetw1Fetal weight QTL 112.10.005fetal growth trait (VT:0004201)fetal body weight (CMO:0002080)188634585106002500Rat
724529Cm16Cardiac mass QTL 162.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)190804143161321256Rat
738022Anxrr13Anxiety related response QTL 134.60.00039locomotor behavior trait (VT:0001392)number of 20 x 20 cm floor squares crossed into, out of or within a discrete space in an experimental apparatus (CMO:0001514)191093646136093646Rat
724521Uae1Urinary albumin excretion QTL 13.80.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)194201400184846632Rat
1358902Bw47Body weight QTL 471.67body mass (VT:0001259)body weight (CMO:0000012)194201400197187904Rat
1302788Scl19Serum cholesterol QTL 194.60.001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)194225372130917265Rat
1300153Bp171Blood pressure QTL 1713.37arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)194364073153076991Rat
724567Tcas6Tongue tumor susceptibility QTL 66.85tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)195304961156446783Rat
1331800Scl25Serum cholesterol level QTL 253.013blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)199983293127203999Rat
1331793Bp200Blood pressure QTL 2003.71601arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)199983293188289386Rat
1331751Bp199Blood pressure QTL 1993.60022arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)199983293198656062Rat
1331749Hrtrt11Heart rate QTL 112.973heart pumping trait (VT:2000009)heart rate (CMO:0000002)199983293216213510Rat
70209Niddm23Non-insulin dependent diabetes mellitus QTL 232.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)199983293216325819Rat
731168Bp154Blood pressure QTL 1543.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1100131562236763528Rat
2293142Bp314Blood pressure QTL 314arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1100354344145354344Rat


Additional Information

Database Acc Id Source(s)
UniSTS 227198 UniSTS