D4Arb11 Marker Search Result - Rat Genome Database

Send us a Message
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   
Search RGD Grant Resources Citing RGD About Us Contact Us
Genes Variants Community Projects QTLs Strains Markers Genome Information Ontologies Cell Lines References Download Submit Data
OntoMate (Literature Search) JBrowse (Genome Browser) Synteny Browser (VCMap) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) AllianceMine GViewer (Genome Viewer)
Aging & Age-Related Disease Behavioral & Substance Use Disorder Cancer & Neoplastic Disease Cardiovascular Disease Coronavirus Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Infectious Disease Liver Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease
Find Models Genetic Models Autism Models Rat PhenoMiner (Quantitative Phenotypes) Chinchilla PhenoMiner Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive
Pathways
Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Presentations Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources
Advanced Search (OLGA)

Marker: D4Arb11

Symbol: D4Arb11
Previously known as: oxsts7866; R0266-A07; 
RGD ID: 42142
Expected Size: 234 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
GRCr8461,638,224 - 61,638,458 (+)Marker Load Pipeline
mRatBN7.2460,670,969 - 60,671,203 (+)MAPPERmRatBN7.2
Rnor_6.0459,390,247 - 59,390,480NCBIRnor6.0
Rnor_5.0459,136,648 - 59,136,881UniSTSRnor5.0
RGSC_v3.4459,197,992 - 59,198,225UniSTSRGSC3.4
Celera455,759,026 - 55,759,259UniSTS
RGSC_v3.1459,474,121 - 59,474,355RGD
RH 3.4 Map4360.2RGD
RH 3.4 Map4360.2UniSTS
RH 2.0 Map4412.7RGD
SHRSP x BN Map432.4399RGD
FHH x ACI Map439.16RGD
Cytogenetic Map4 RGD
Is Marker For: Strains:   ACI/N   BBDR/Rhw   BBDP/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN-Lx/Cub   BN/SsNHsd   BUF/Pit   COP/OlaHsd   DA/PitN   FHH/Eur   F344/Pit   GH/Omr   GK/KyoSwe   DON/Melb   M520/N   IS/Kyo   WN/N   LH/Mav   LE/Mol   LEW/Pit   LOU/CHan   LN/Mav   MHS/Gib   MNR/N   MNRA/N   MNS/Gib   MR/Pit   NEDH/K   NP9   ODU/N   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SR/Jr   SHRSP/Riv   SS/Jr   WAG/RijKyo   WF/Pit   WIST/Nhg   WTC/Kyo  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8. Electronic Submission of SSLP Data Sets Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence
 
Forward Primer AGCCTAACTAAAACAGTGTG
Reverse Primer TAGCCTACTTGGTGAGTTCC
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473959 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000234 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (GRCr8)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
5685012Bmd87Bone mineral density QTL 875.1tibia mineral mass (VT:1000283)bone mineral content (CMO:0001554)43511329080113290Rat
1358352Srcrt3Stress Responsive Cort QTL 32.29blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)439431983123203361Rat
1549843Bw53Body weight QTL 530.0001body mass (VT:0001259)body weight gain (CMO:0000420)459753119104753119Rat
61445Strs3Sensitivity to stroke QTL 33cerebrum integrity trait (VT:0010549)post-insult time to onset of cerebrovascular lesion (CMO:0002343)44140057786400577Rat
6893678Bw108Body weight QTL 1082.60.006body mass (VT:0001259)body weight (CMO:0000012)44442502489425024Rat
5685009Bmd86Bone mineral density QTL 863.7tibia mineral mass (VT:1000283)bone mineral density (CMO:0001226)457613242102613242Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)427730518170099664Rat
1331807Rf31Renal function QTL 312.988urine potassium amount (VT:0010539)urine potassium level (CMO:0000128)44049044275726188Rat
634311Sach7Saccharin preference QTL 7taste sensitivity trait (VT:0001986)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)45807987582597589Rat
1358363Sradr3Stress Responsive Adrenal Weight QTL 36.19adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)458817672103817672Rat
61330Eau1Experimental allergic uveoretinitis QTL 10.0003uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)426234499134199155Rat
738009Sach4Saccharine consumption QTL 44.90.000016consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)460916264184426481Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)41170660492690519Rat
61336Bp21Blood pressure QTL 214.6arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45808014680212111Rat
2313401Anxrr27Anxiety related response QTL 27aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)41890069763900697Rat
2312569Pur19Proteinuria QTL 193.40.001urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)459836842104836842Rat
8655961Kidm43Kidney mass QTL 4318kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)43726957782269577Rat
1354612Foco1Food consumption QTL 18.87eating behavior trait (VT:0001431)food intake rate (CMO:0000427)445429897149763204Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)427862204126119996Rat
634344Hcar7Hepatocarcinoma resistance QTL 77.8liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)46104105794638356Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)45889999148002343Rat
61475Aia2Adjuvant induced arthritis QTL 25.8joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)44047145375939996Rat
8694439Bw168Body weight QTL 1689.570.001retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)44140060386400603Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)42228845363245191Rat
738031Alc14Alcohol consumption QTL 147.60.00003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)460916264174095838Rat
8552807Vie4Viral induced encephalitis QTL 47.3brain integrity trait (VT:0010579)encephalitis incidence/prevalence measurement (CMO:0002361)41890069763900697Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)43044896182336920Rat
1576305Emca6Estrogen-induced mammary cancer QTL 65.8mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)445429709157555683Rat
7387227Uae40Urinary albumin excretion QTL 402.90.0052urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)41891315163913151Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42786220462997402Rat
738016Alc16Alcohol consumption QTL 163.60.00015consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)460916264184426481Rat
1558651Swd3Spike wave discharge measurement QTL 34.620.000024brain electrophysiology trait (VT:0010557)brain spike-and-wave discharge frequency (CMO:0001742)44140057786400577Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)42192515166925151Rat
1354660Salc1Saline consumption QTL 111.26drinking behavior trait (VT:0001422)saline drink intake rate (CMO:0001627)445429897149763204Rat
1641833Alc21Alcohol consumption QTL 218.60.0001drinking behavior trait (VT:0001422)ethanol drink intake rate (CMO:0001407)457664252127749483Rat
70192BpQTLcluster5Blood pressure QTL cluster 54.183arterial blood pressure trait (VT:2000000)absolute change in mean arterial blood pressure (CMO:0000533)4163900697Rat
1298082Stresp4Stress response QTL 4blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)451085655113588029Rat
631546Bp86Blood pressure QTL 863.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)45807987592690793Rat
1300139Hrtrt6Heart rate QTL 62.85heart pumping trait (VT:2000009)heart rate (CMO:0000002)440490442117737312Rat
70200Alc18Alcohol consumption QTL 189.2drinking behavior trait (VT:0001422)ethanol intake volume to total fluid intake volume ratio (CMO:0001591)457613339151163960Rat
12798520Anxrr55Anxiety related response QTL 554.450.01locomotor behavior trait (VT:0001392)number of rearing movements with lid-pushing in an experimental apparatus (CMO:0002715)433538597116185060Rat
4889969Bss96Bone structure and strength QTL 964.9tibia size trait (VT:0100001)tibia cortical bone volume (CMO:0001725)457613242102613242Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)412212457182430611Rat
4889972Bss97Bone structure and strength QTL 975.6tibia size trait (VT:0100001)tibia total bone volume (CMO:0001724)457613242102613242Rat
631671Iddm11Insulin dependent diabetes mellitus QTL 113.60.0012blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)45960331980216952Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Nucleotide L24174
  L24175