D11Arb4 Marker Search Result - Rat Genome Database

General

Marker: D11Arb4

Symbol:

D11Arb4

Previously known as:

D11N161; R0269-A01; oxsts7658;

RGD ID:

41954

Expected Size:

236 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	11	66,422,141 - 66,422,377 (+)	MAPPER	mRatBN7.2
Rnor_6.0	11	69,649,701 - 69,649,936	NCBI	Rnor6.0
Rnor_5.0	11	72,739,680 - 72,739,915	UniSTS	Rnor5.0
RGSC_v3.4	11	68,234,774 - 68,235,010	RGD	RGSC3.4
RGSC_v3.4	11	68,234,775 - 68,235,010	UniSTS	RGSC3.4
RGSC_v3.1	11	68,292,364 - 68,292,599	RGD
Celera	11	65,874,133 - 65,874,348	UniSTS
RH 3.4 Map	11	416.8	UniSTS
RH 3.4 Map	11	416.8	RGD
RH 2.0 Map	11	147.1	RGD
SHRSP x BN Map	11	29.8399	RGD
Cytogenetic Map	11	q22	UniSTS

Is Marker For:

Strains: BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BUF/Pit DA/PitN F344/Pit FHH/Eur LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit WIST/Nhg SR/Jr MNS/Gib NP9 OKA/Wsl OM/Ztm P5C PVG/Pit SD/Rij SHR/OlaHsd WAG/RijKyo GK/KyoSwe M520/N ACI/N BN-Lx/Cub LN/Mav NEDH/K SS/Jr F344.HTX-(D11Rat4-D11Arb4)/Hcj COP/OlaHsd
Genes: Kalrn

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence.	Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5.	UniSTS Pipeline	RGD automated pipelines
6.	RH Map Project	RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7.	A high density integrated genetic linkage and radiation hybrid map of the laboratory rat	Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8
8.	Electronic Submission of SSLP Data Sets	Wilder R. Oct.2000. National Institute of Arthritis and Musculoskeletal and Skin Diseases, ARB Rat Genetic Database

Strains and Sequence

Sequence


Forward Primer	CCTTCCCTCCATGTTGTTCACCC
Reverse Primer	TCATAGTGTCCTGCTGGCTGTGC

Strain Variation

Strain, Expected Size(s)

ACI/N	257
BBDR/Rhw	215
BC/CpbU	257
BDIX/Han	257
BDVII/Cub	257
BN-Lx/Cub	235
BN/SsNHsd	235
BUF/Pit	257
COP/OlaHsd	257
DA/PitN	257
F344/Pit	221

FHH/Eur	257
GK/KyoSwe	215
LE/Mol	227
LEW/Pit	215
LH/Mav	215
LN/Mav	215
LOU/CHan	215
M520/N	221
MHS/Gib	257
MNR/N	215
MNRA/N	215

MNS/Gib	227
MR/Pit	215
NEDH/K	215
NP9	257
ODU/N	257
OKA/Wsl	257
OM/Ztm	219
P5C	257
PVG/Pit	215
SD/Rij	257
SHR/OlaHsd	257

SR/Jr	215
SS/Jr	215
WAG/RijKyo	215
WF/Pit	257
WIST/Nhg	215
WKY/OlaHsd	265
WN/N	219
WTC/Kyo	257

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
621865	Kalrn	kalirin, RhoGEF kinase	11	66198155	66803166	Rat

Nucleotide Sequences


GenBank Nucleotide	L11655	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300147	Bp187	Blood pressure QTL 187	3.67		arterial blood pressure trait (VT:2000000)	blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)	11	1	69446234	Rat
724554	Iddm17	Insulin dependent diabetes mellitus QTL 17		0.001	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	11	18976208	86241447	Rat
10058952	Gmadr6	Adrenal mass QTL 6	2.29	0.0072	adrenal gland mass (VT:0010420)	both adrenal glands wet weight to body weight ratio (CMO:0002411)	11	22959403	67959403	Rat
8694376	Bw156	Body weight QTL 156	2.25	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	11	23280456	68280456	Rat
9590313	Scort20	Serum corticosterone level QTL 20	6.51	0.001	blood corticosterone amount (VT:0005345)	plasma corticosterone level (CMO:0001173)	11	23280456	68280456	Rat
9589032	Epfw10	Epididymal fat weight QTL 10	9.29	0.001	epididymal fat pad mass (VT:0010421)	epididymal fat pad weight to body weight ratio (CMO:0000658)	11	23280456	68280456	Rat
8694424	Bw162	Body weight QTL 162	3.8	0.001	body lean mass (VT:0010483)	lean tissue morphological measurement (CMO:0002184)	11	23280456	68280456	Rat
724563	Uae10	Urinary albumin excretion QTL 10	6		urine albumin amount (VT:0002871)	urine albumin level (CMO:0000130)	11	27672410	82846715	Rat
1300110	Stl7	Serum triglyceride level QTL 7	4.64		blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	11	29528418	82566702	Rat
2298551	Neuinf10	Neuroinflammation QTL 10	3.7		nervous system integrity trait (VT:0010566)	spinal cord beta-2 microglobulin mRNA level (CMO:0002125)	11	31239134	78851519	Rat
70180	BpQTLcluster10	Blood pressure QTL cluster 10	3.19		arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	11	34918041	79918041	Rat
1300135	Rf19	Renal function QTL 19	3.38		blood creatinine amount (VT:0005328)	creatinine clearance (CMO:0000765)	11	40946188	82566702	Rat
2312566	Glom20	Glomerulus QTL 20	3.6	0.001	kidney glomerulus morphology trait (VT:0005325)	index of glomerular damage (CMO:0001135)	11	44285759	82566702	Rat
1581565	Pur10	Proteinuria QTL 10		0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	11	44803318	82846466	Rat
1581572	Uae35	Urinary albumin excretion QTL 35		0.0001	urine albumin amount (VT:0002871)	urine albumin excretion rate (CMO:0000757)	11	44803318	82846466	Rat
4889859	Pur28	Proteinuria QTL 28	19.5	0.001	urine total protein amount (VT:0000032)	urine total protein excretion rate (CMO:0000756)	11	45459323	75190161	Rat
724561	Plsm4	Polydactyly-luxate syndrome (PLS) morphotypes QTL 4		0.0003	forelimb integrity trait (VT:0010562)	front foot phalanges count (CMO:0001947)	11	54457534	86241447	Rat
4889521	Gluco62	Glucose level QTL 62	2.82	0.001	blood glucose amount (VT:0000188)	blood glucose level (CMO:0000046)	11	55136729	82993457	Rat
7411658	Foco27	Food consumption QTL 27	16.2	0.001	eating behavior trait (VT:0001431)	feed conversion ratio (CMO:0001312)	11	56351424	86241447	Rat
631506	Bp104	Blood pressure QTL 104	2.8		arterial blood pressure trait (VT:2000000)	systolic blood pressure (CMO:0000004)	11	59802794	82566545	Rat
70208	Niddm22	Non-insulin dependent diabetes mellitus QTL 22	3.61		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	11	59802794	82566553	Rat
10058954	Gmadr7	Adrenal mass QTL 7	2.49	0.0049	adrenal gland mass (VT:0010420)	both adrenal glands wet weight to body weight ratio (CMO:0002411)	11	60346590	86241447	Rat
1549848	Bvd6	Brain ventricular dilatation QTL 6	3.1	0.0001	brain ventricle morphology trait (VT:0000822)	hydrocephalus severity score (CMO:0001881)	11	66113321	82169223	Rat
634339	Niddm50	Non-insulin dependent diabetes mellitus QTL 50	3.32		blood glucose amount (VT:0000188)	plasma glucose level (CMO:0000042)	11	66422148	86241447	Rat
1354593	Stl12	Serum triglyceride level QTL 12	3.36		blood triglyceride amount (VT:0002644)	serum triglyceride level (CMO:0000360)	11	66422148	86241447	Rat

Additional Information

RGD Curation Notes

Note Type	Note	Reference

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	84009	UniSTS
NCBI Nucleotide	L11655
UniSTS	120744	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D11Arb4