D9Rat163 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D9Rat163

Symbol: D9Rat163
Also known as: R0290-A11; oxsts7502; 
RGD ID: 41672
Expected Size: 232 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.09110,038,581 - 110,038,814NCBIRnor6.0
Rnor_5.09109,609,344 - 109,609,577UniSTSRnor5.0
RGSC_v3.49101,209,211 - 101,209,443RGDRGSC3.4
RGSC_v3.49101,209,212 - 101,209,445UniSTSRGSC3.4
RGSC_v3.19101,418,691 - 101,418,923RGD
FHH x ACI Map981.3UniSTS
FHH x ACI Map981.3RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Swd1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CCGATGAAAGCCCTGTCTAA
Reverse Primer GAAGTCCTGTTCTGCCTTGC
 

Region

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)929075079122095297Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)966757444112943287Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)970241351115241351Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)970942881115942881Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)981411073119983851Rat
724547Cm21Cardiac mass QTL 212.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)983686153111609081Rat
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)990024661119983851Rat
1354645Swd1Spike wave discharge measurement QTL 13.910.00012brain electrophysiology trait (VT:0010557)mean duration of a single type I spike-and-wave discharge train (CMO:0002064)9107198926110038814Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 544538 UniSTS
UniSTS 228341 UniSTS