D8Rat159 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D8Rat159

Symbol: D8Rat159
Also known as: R0112-A01; oxsts11526; 
RGD ID: 41122
Expected Size: 216 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
RH 3.4 Map8458.3RGD
RH 3.4 Map8458.3UniSTS
RH 2.0 Map8373.8RGD
SHRSP x BN Map835.78RGD
Is Marker For: Strains:   AVN/Orl   BBDR/Rhw   BC/CpbU   BDIX/Han   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Rf17   Cm3   Cm2   Scort6   Vetf5  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CTTTGCCGAGCTCAGCTTA
Reverse Primer CTAGGCATTTGTTTCCGCAT
 

Region

Nucleotide Sequences


Additional Information

Database Acc Id Source(s)
NCBI Gene 444945 UniSTS
  444949 UniSTS
  444976 UniSTS
UniSTS 122423 UniSTS