D18Rat80 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D18Rat80

Symbol: D18Rat80
Also known as: R0099-C01; oxsts9985; 
RGD ID: 40918
Expected Size: 126 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01876,168,501 - 76,168,619NCBIRnor5.0
Rnor_5.016593,391 - 593,510NCBIRnor5.0
Rnor_5.01872,252,662 - 72,252,780NCBIRnor5.0
Rnor_5.016593,392 - 593,510NCBIRnor5.0
Rnor_5.01872,252,662 - 72,252,781NCBIRnor5.0
Rnor_5.01876,168,500 - 76,168,619NCBIRnor5.0
RGSC_v3.41876,935,778 - 76,935,896RGDRGSC3.4
RGSC_v3.41876,935,779 - 76,935,896UniSTSRGSC3.4
RGSC_v3.11877,009,051 - 77,009,169RGD
Celera1872,154,615 - 72,154,732UniSTS
SHRSP x BN Map1847.8399RGD
SHRSP x BN Map1847.8399UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Glom11   Mcs34  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GGGCCTCTTGTTCCTAGGAT
Reverse Primer AACTGGGCAGAATGAACCC
 

Region



Additional Information

Database Acc Id Source(s)
NCBI Gene 100303228 UniSTS
UniSTS 226952 UniSTS