D9Rat109 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D9Rat109

Symbol: D9Rat109
Also known as: R0231-B12; oxsts7493; 
RGD ID: 40510
Expected Size: 150 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.09107,198,926 - 107,199,079NCBIRnor6.0
Rnor_5.09106,780,549 - 106,780,702UniSTSRnor5.0
RGSC_v3.49100,495,067 - 100,495,220UniSTSRGSC3.4
RGSC_v3.49100,495,066 - 100,495,220RGDRGSC3.4
RGSC_v3.19100,704,225 - 100,704,716RGD
Celera999,018,894 - 99,019,047UniSTS
SHRSP x BN Map970.4499UniSTS
SHRSP x BN Map970.4499RGD
FHH x ACI Map981.3RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Swd1   Pur26  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CAAGGCTTTCAATGGGTACA
Reverse Primer GCCTGGAAATTAGCTTGACG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473997 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000239 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
731164Uae25Urinary albumin excretion QTL 253.50.0001urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)929466970107878528Rat
4889852Pur26Proteinuria QTL 26150.001total urine protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)990024661107199079Rat
7794784Mcs31Mammary carcinoma susceptibility QTL 312.98mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)990024661119983851Rat
1300134Bp185Blood pressure QTL 1853.73arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)966757444112943287Rat
1354626Bvd1Brain ventricular dilatation QTL 13.730.001brain ventricle morphology trait (VT:0000822)hydrocephalus severity score (CMO:0001881)981411073119983851Rat
1354645Swd1Spike wave discharge measurement QTL 13.910.00012brain electrophysiology trait (VT:0010557)mean duration of a single type I spike-and-wave discharge train (CMO:0002064)9107198926110038814Rat
1582203Gluco19Glucose level QTL 193.30.001blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)999041068107878528Rat
61385Edpm9Estrogen-dependent pituitary mass QTL 93.430.05pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)970241351115241351Rat
724515Uae16Urinary albumin excretion QTL 168urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)963270073107878387Rat
724544Uae9Urinary albumin excretion QTL 94.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)929075079122095297Rat
731171Glom6Glomerulus QTL 62.80.0003kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli not directly contacting the kidney surface (CMO:0001002)970942881115942881Rat
724547Cm21Cardiac mass QTL 212.7heart mass (VT:0007028)calculated heart weight (CMO:0000073)983686153111609081Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 100528038 UniSTS
  544538 UniSTS
UniSTS 122489 UniSTS