D8Rat71 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D8Rat71

Symbol: D8Rat71
Also known as: R0080-C09; oxsts7471; 
RGD ID: 38898
Expected Size: 234 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.28122,812,566 - 122,812,818 (+)MAPPER
Rnor_6.08132,243,591 - 132,243,842NCBIRnor6.0
Rnor_5.08131,397,184 - 131,397,435UniSTSRnor5.0
RGSC_v3.48127,906,996 - 127,907,359RGDRGSC3.4
RGSC_v3.48127,907,014 - 127,907,265UniSTSRGSC3.4
RGSC_v3.18127,926,751 - 127,927,002RGD
Celera8121,925,567 - 121,925,818UniSTS
RH 3.4 Map81259.4UniSTS
RH 3.4 Map81259.4RGD
SHRSP x BN Map885.2699UniSTS
SHRSP x BN Map885.2699RGD
Cytogenetic Map8q32UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BN/SsNHsd   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   IS/Kyo   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   MNS/Gib   NP9   OKA/Wsl   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Cia6  
Genes:   Exosc7   Clec3b  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TAGGGACTGCCTGTGTAGGG
Reverse Primer GGCTTTAGTGGGTGGACAAA
 
Template
CCAAGCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCCACAATTCCTTGGCAAGGCTTTA
GTGGGTGGACAAAGACTCTGACCTCATCAATGTGGACTTCACATGAAGTGTCCTTGGAGGTCCC
TACCCTTTGCCTCAAGCCAAACAGATCTTTTCTGGGAACCCCTGGGACTTCAGAAAGACAGGGG
TTCACCCAGCTTTCAGCGCGCGCGNTGCGCGCACATCACACACACACACACACACACTCACACA
CACTCATAGTCCCTTCCCTACACAGGCAGTCCCTATTAGAGATGCCATGTATCATGAAACAGAT
GGGAAAAGTGTGGTTCTGTGGCTACTTGGATCAGAGCTTTGGGCAAGCTGCTCTACCATCCTGG
GGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTNTTATCCGCT
CACAATNCCACACAACATACGAGCCGGAAGCATAAAGTGTAAANCTGGGGTNCTAATGAGTGGC
TACTCACATTAATTGCGTGCGTCCTC

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1311031Clec3bC-type lectin domain family 3, member B8132241016132248066Rat

Nucleotide Sequences
GenBank Nucleotide CH473954 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000238 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61437Cia6Collagen induced arthritis QTL 6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)889058229132243842Rat
1358893Bp263Blood pressure QTL 2635.01arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)8100873811133307652Rat
1358903Bp252Blood pressure QTL 25270.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)8100873811133307652Rat
738011Anxrr9Anxiety related response QTL 96.1exploratory behavior trait (VT:0010471)number of entries into a discrete space in an experimental apparatus (CMO:0000960)8102051964133307652Rat
738014Anxrr15Anxiety related response QTL 153.60.005locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)8104682575133307652Rat
2300182Bmd56Bone mineral density QTL 565.4femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)8104682575133307652Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100912012 UniSTS
  316098 UniSTS
  326442 UniSTS
UniSTS 119130 UniSTS