D1Rat223 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Rat223

Symbol: D1Rat223
Previously known as: R0065-B12; oxsts6629; 
RGD ID: 37982
Expected Size: 208 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.21222,987,545 - 222,987,745 (+)MAPPERmRatBN7.2
Rnor_6.01243,311,415 - 243,311,614NCBIRnor6.0
Rnor_5.01250,572,809 - 250,573,008UniSTSRnor5.0
RGSC_v3.41228,780,913 - 228,781,113RGDRGSC3.4
RGSC_v3.41228,780,914 - 228,781,113UniSTSRGSC3.4
RGSC_v3.11228,944,937 - 228,945,136RGD
Celera1220,189,134 - 220,189,333UniSTS
RH 3.4 Map11611.9UniSTS
RH 3.4 Map11611.9RGD
SHRSP x BN Map1118.6299UniSTS
SHRSP x BN Map1118.6299RGD
Cytogenetic Map1q51UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Hcas3  
Genes:   Kank1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer TAAACCTCTGCCCCAGTGAC
Reverse Primer TTGTTCCACCTTCCTCCTTG
 
Template
TGCATGCCTGCAGGTCGACTCTAGAGGATCCCCCTTTATTGTTCCACCTTCCTCCTTGTACAAG
GGGATATTTGGAAAATCCCAGACCCAAGGTCACCCCCCTACACACACACACACACACACACACA
CACACACACACACACACACACACACACACACAATCACTCTTCAAATTGGTGTTTTCTCCAAGGT
ACTGCCTTGCTCACTGAAGTACTCCACAGAAATAGTCACTGGGGCAGAGGTTTAGGGTCCAGTG
AACAGAAAGAAGGGGTACCGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAA
TTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGT
GCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAA
ACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCG

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1307714Kank1KN motif and ankyrin repeat domains 11222877962223074514Rat

Nucleotide Sequences
GenBank Nucleotide CH473953 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
7794788Mcs32Mammary carcinoma susceptibility QTL 322.61mammary gland integrity trait (VT:0010552)mammary tumor incidence/prevalence measurement (CMO:0000946)1115540693238914717Rat
7421630Bp362Blood pressure QTL 3620.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1118608292241799120Rat
737828Hcas3Hepatocarcinoma susceptibility QTL 34.9liver integrity trait (VT:0010547)liver tumorous lesion volume to total liver volume ratio (CMO:0001082)1144267353222987745Rat
2302378Insul11Insulin level QTL 113.25blood insulin amount (VT:0001560)serum insulin level (CMO:0000358)1144267353251128347Rat
724531Uae5Urinary albumin excretion QTL 54urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)1150700142252085212Rat
1578759Uae30Urinary albumin excretion QTL 303.30.003urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1150700247252085048Rat
1578778Pur4Proteinuria QTL 43.30.003urine total protein amount (VT:0000032)urine total protein excretion rate (CMO:0000756)1150700247252085048Rat
1354610Bw34Body weight QTL 344.1body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1354646Kidm18Kidney mass QTL 185.7kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1151162512256448636Rat
1354661Bw33Body weight QTL 335.2body mass (VT:0001259)body weight (CMO:0000012)1151162512256448636Rat
1358886Bp260Blood pressure QTL 2603.67arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1151162766225824951Rat
1549837Hcar15Hepatocarcinoma resistance QTL 150.05liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1153136852260522016Rat
1354580Scort1Serum corticosterone level QTL 13.4blood corticosterone amount (VT:0005345)blood corticosterone level (CMO:0001172)1156677124256448636Rat
2292220Bp306Blood pressure QTL 3063.470.00087arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1164310393243914901Rat
738032Hcas5Hepatocarcinoma susceptibility QTL 53.12liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1176426412257976495Rat
1354624Cm35Cardiac mass QTL355.7heart left ventricle mass (VT:0007031)calculated heart weight (CMO:0000073)1177227632256448636Rat
1354652Kidm20Kidney mass QTL 204.3kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1177227632256448636Rat
1558658Bw59Body weight QTL 593.50.0003body mass (VT:0001259)body weight (CMO:0000012)1178784622223784622Rat
634321Hc1Hypercalciuria QTL 12.91urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1178810256240830002Rat
1578763Kidm29Kidney mass QTL 293.30.0001kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)1179567751260522016Rat
737977Bp160Blood pressure QTL 1600.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1181133855226133855Rat
2293083Iddm25Insulin dependent diabetes mellitus QTL 254.18blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1181829673224569684Rat
8655655Arrd2Age-related retinal degeneration QTL 27.79retinal layer morphology trait (VT:0003727)percentage of study population developing retinopathy during a period of time (CMO:0002453)1183970203243914901Rat
8655855Arrd3Age-related retinal degeneration QTL 33.07lens clarity trait (VT:0001304)cataract incidence/prevalence measurement (CMO:0001585)1183970203243914901Rat
631838Niddm36Non-insulin dependent diabetes mellitus QTL 360.01insulin secretion trait (VT:0003564)calculated pancreatic islet insulin release measurement (CMO:0001217)1184550676229550676Rat
2312564Glom18Glomerulus QTL 182.40.003kidney glomerulus morphology trait (VT:0005325)index of glomerular damage (CMO:0001135)1185356336231689108Rat
1582206Kidm33Kidney mass QTL 336.9kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1188377360224054420Rat
1358898Bp255Blood pressure QTL 2553.6arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1191019702246062233Rat
10059590Kidm44Kidney mass QTL 443.420.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1191033875236033875Rat
1358191Ept10Estrogen-induced pituitary tumorigenesis QTL 103.8pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)1192825253243914732Rat
8552891Epfw5Epididymal fat weight QTL 54.4epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1193113876238113876Rat
1600388Niddm67Non-insulin dependent diabetes mellitus QTL 675.840.000004blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
1600395Niddm69Non-insulin dependent diabetes mellitus QTL 694.140.0002blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)1195804352257091168Rat
1600396Niddm68Non-insulin dependent diabetes mellitus QTL 684.970.0003blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1195804352257091168Rat
631658Cm7Cardiac mass QTL 75.320.0001aorta mass (VT:0002845)aorta weight (CMO:0000076)1196248093241248093Rat
1358292Cm37Cardiac mass QTL 376.20.00000081heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)1196248093241248093Rat
1600374Mcs17Mammary carcinoma susceptibility QTL 173mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)1197670404242670404Rat
1641926Teswt2Testicular weight QTL 22.82testis mass (VT:1000644)both testes wet weight (CMO:0000175)1197697768238755659Rat
2302375Bw83Body weight QTL 834.870.0002body mass (VT:0001259)body weight (CMO:0000012)1197697768242697768Rat
61376Bp42Blood pressure QTL 4223.4arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1197814409242814409Rat
1298084Thym4Thymus enlargement QTL 410.68thymus mass (VT:0004954)thymus weight to body weight ratio (CMO:0000612)1197814409242814409Rat
1357335Bw39Body weight QTL 393.3body mass (VT:0001259)body weight (CMO:0000012)1197814409242814409Rat
1331790Bp201Blood pressure QTL 2013.127arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1198211513225126682Rat
634313Niddm43Non-insulin dependent diabetes mellitus QTL 43blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1199050459259647894Rat
2292218Kidm35Kidney mass QTL 35kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1199368955224569684Rat
2293694Bss38Bone structure and strength QTL 387.050.0001femur strength trait (VT:0010010)femur stiffness (CMO:0001674)1201554356246554356Rat
7394701Uae46Urinary albumin excretion QTL 463.60.0056urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1201554356246554356Rat
2300175Bmd40Bone mineral density QTL 4015.40.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)1201554356246554356Rat
2293655Bss36Bone structure and strength QTL 3610.660.0001femur strength trait (VT:0010010)femur ultimate force (CMO:0001675)1201554356246554356Rat
2293674Bss39Bone structure and strength QTL 397.10.0001femur strength trait (VT:0010010)femur total energy absorbed before break (CMO:0001677)1201554356246554356Rat
10059587Bw173Body weight QTL 1733.230.025body mass (VT:0001259)body weight (CMO:0000012)1202069611247069611Rat
1600363Hc6Hypercalciuria QTL 62.7urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1203995416244113296Rat
1600397Edcs4Endometrial carcinoma susceptibility QTL 42.2uterus morphology trait (VT:0001120)percentage of study population developing endometrioid carcinoma during a period of time (CMO:0001759)1206081677251081677Rat
1357399Bw45Body weight QTL 453.05body mass (VT:0001259)body mass index (BMI) (CMO:0000105)1206329708251329708Rat
1357404Bw42Body weight QTL 424.490.0001body mass (VT:0001259)body weight (CMO:0000012)1206329708251329708Rat
1300168Bp170Blood pressure QTL 1702.76arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1207702246228581766Rat
1358916Kidm22Kidney mass QTL 223.32kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)1210702053240947965Rat
1358890Bp259Blood pressure QTL 2593.06arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)1210702053260522016Rat
2292216Bw80Body weight QTL 803.230.0019body mass (VT:0001259)body weight (CMO:0000012)1213533809243914901Rat
724538Kidm1Kidney mass QTL 13.2kidney mass (VT:0002707)calculated kidney weight (CMO:0000160)1213707201252085212Rat
734768Niddm59Non-insulin dependent diabetes mellitus QTL 59body mass (VT:0001259)body weight (CMO:0000012)1213843987258843987Rat
634340Hcar5Hepatocarcinoma resistance QTL 58liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)1214537555226660468Rat
61455Niddm7Non-insulin dependent diabetes mellitus QTL 75.5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)1214537555238757011Rat
70211Niddm24Non-insulin dependent diabetes mellitus QTL 243.79blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1214647894259647894Rat
1549910Bw54Body weight QTL 540.05body mass (VT:0001259)body weight (CMO:0000012)1214647894259647894Rat
61327Eae7Experimental allergic encephalomyelitis QTL 75.6body mass (VT:0001259)change in body weight (CMO:0002045)1216255568260522016Rat
2302040Pia35Pristane induced arthritis QTL 353.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)1216255568260522016Rat
5508828Leukc3Leukocyte quantity QTL 3eosinophil quantity (VT:0002602)blood eosinophil count (CMO:0000033)1218108584224054420Rat
1598821Rf55Renal function QTL 556.3renal blood flow trait (VT:2000006)ratio of change in renal blood flow to change in renal perfusion pressure (CMO:0001239)1218748008257976495Rat
61400Niddm1Non-insulin dependent diabetes mellitus QTL 111blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1218753689245907899Rat
724533Rf51Renal function QTL 515.30.0002kidney plasma flow trait (VT:0005524)renal plasma flow (CMO:0001914)1218753816256448513Rat
731175Uae20Urinary albumin excretion QTL 203.50.0018urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)1221264111259647894Rat
10053715Scort24Serum corticosterone level QTL 242.130.0088blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1221414816260522016Rat
724552Glom2Glomerulus QTL 23.30.0001kidney glomerulus morphology trait (VT:0005325)count of superficial glomeruli directly contacting the kidney surface (CMO:0001001)1222363780260522016Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 309429 UniSTS
  408100 UniSTS
UniSTS 118562 UniSTS