DXRat53 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: DXRat53

Symbol: DXRat53
Also known as: R0062-A05; oxsts11797; 
RGD ID: 37772
Expected Size: 279 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
mRatBN7.25103,857,355 - 103,857,402 (+)MAPPERmRatBN7.2
mRatBN7.2179,536,234 - 79,536,294 (+)MAPPERmRatBN7.2
mRatBN7.21048,432,239 - 48,432,272 (-)MAPPERmRatBN7.2
mRatBN7.2739,100,176 - 39,100,207 (-)MAPPERmRatBN7.2
mRatBN7.2X18,403,104 - 18,403,385 (-)MAPPERmRatBN7.2
Rnor_6.0X19,292,869 - 19,293,154NCBIRnor6.0
Rnor_6.0X19,245,739 - 19,246,017NCBIRnor6.0
Rnor_5.0X20,011,470 - 20,011,748UniSTSRnor5.0
RGSC_v3.4X38,582,727 - 38,582,995UniSTSRGSC3.4
RGSC_v3.4X38,516,405 - 38,516,745RGDRGSC3.4
RGSC_v3.4X38,516,455 - 38,516,733UniSTSRGSC3.4
RGSC_v3.1X38,636,196 - 38,636,464RGD
CeleraX18,625,109 - 18,625,377UniSTS
RH 3.4 MapX187.5RGD
RH 3.4 MapX187.5UniSTS
RH 2.0 Map21198.2RGD
FHH x ACI MapX5.73RGD
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDVII/Cub   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   IS/Kyo   LE/Mol   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   M520/N   ACI/N   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TCTTTGTATGTTCTCAGTCAGGTCA
Reverse Primer TCCAGGCACTGGAGTCTCTT
 

Region

Nucleotide Sequences
GenBank Nucleotide CH474063 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000251 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (mRatBN7.2)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1554320Bmd1Bone mineral density QTL 112.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)150910886060548Rat
631688Hcas2Hepatocarcinoma susceptibility QTL 230.0001liver integrity trait (VT:0010547)liver tumorous lesion number (CMO:0001068)15925874115540829Rat
2313062Bmd73Bone mineral density QTL 733.90.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)11148131282174945Rat
2313065Bss67Bone structure and strength QTL 673.10.0001tibia area (VT:1000281)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313069Bss68Bone structure and strength QTL 682.90.0001tibia size trait (VT:0100001)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
2313075Bss66Bone structure and strength QTL 663.40.0001tibia length (VT:0004357)tibia length (CMO:0000450)11148131282174945Rat
2313077Bss69Bone structure and strength QTL 693.50.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)11148131282174945Rat
2313092Bmd72Bone mineral density QTL 722.50.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)11148131282174945Rat
2313097Bss70Bone structure and strength QTL 703.50.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)11148131282174945Rat
631495Bp96Blood pressure QTL 964.52arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)122340647102268831Rat
1358359Sradr1Stress Responsive Adrenal Weight QTL 14.74adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)130882023123479925Rat
70225Bp58Blood pressure QTL 583.3arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132356093162846471Rat
1300172Bp172Blood pressure QTL 1723.56arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)13273727390665040Rat
10059597Bp377Blood pressure QTL 3773.420.025arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)132737458199368955Rat
8552900Pigfal1Plasma insulin-like growth factor 1 level QTL 17.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
8552948Pigfal11Plasma insulin-like growth factor 1 level QTL 114.7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)13483685879836858Rat
9589820Insglur3Insulin/glucose ratio QTL 310.750.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)13483685879836858Rat
2313051Bss57Bone structure and strength QTL 573.70.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)143284731118944897Rat
2313059Bss55Bone structure and strength QTL 553.20.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313072Bss53Bone structure and strength QTL 534.30.0001tibia length (VT:0004357)tibia length (CMO:0000450)143284731118944897Rat
2313078Bss54Bone structure and strength QTL 543.50.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)143284731118944897Rat
2313094Bss58Bone structure and strength QTL 583.70.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)143284731118944897Rat
2313098Bmd70Bone mineral density QTL 703.60.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)143284731118944897Rat
2313099Bss56Bone structure and strength QTL 562.40.0001tibia size trait (VT:0100001)tibia midshaft endosteal cross-sectional area (CMO:0001716)143284731118944897Rat
2302059Pia36Pristane induced arthritis QTL 363.80.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)14333300288333002Rat
2313402Anxrr24Anxiety related response QTL 24aggression-related behavior trait (VT:0015014)tameness/aggressiveness composite score (CMO:0002136)148963584144267916Rat
4889962Bss94Bone structure and strength QTL 943.8tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)14936146582174945Rat
1578649Bmd8Bone mineral density QTL 84.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)14939317294393172Rat
1578654Bss10Bone structure and strength QTL 104femur morphology trait (VT:0000559)femoral neck cortical cross-sectional area (CMO:0001702)149393172159356837Rat
634314Niddm44Non-insulin dependent diabetes mellitus QTL 44blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)149393289199050459Rat
6903308Scl36Serum cholesterol QTL 3620.0125blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)15386304190532583Rat
4889919Bss86Bone structure and strength QTL 864.1tibia area (VT:1000281)tibia midshaft total cross-sectional area (CMO:0001715)15389511782174945Rat
4889929Bss87Bone structure and strength QTL 876.7tibia area (VT:1000281)tibia-fibula cortical bone endosteal cross-sectional area (CMO:0001722)15389511782174945Rat
61342Bp27Blood pressure QTL 273.40.0006arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)15673266898773277Rat
2300164Bmd44Bone mineral density QTL 445.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)156949932101949932Rat
2298545Neuinf8Neuroinflammation QTL 84.6nervous system integrity trait (VT:0010566)spinal cord beta-2 microglobulin mRNA level (CMO:0002125)157336763151090257Rat
1300121Hrtrt1Heart rate QTL 13.7heart pumping trait (VT:2000009)heart rate (CMO:0000002)165789093115540829Rat
7421628Bp361Blood pressure QTL 3610.001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)166023617118608521Rat
631512Scl6Serum cholesterol level QTL 69.6blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)17219768090508767Rat
1358192Ept13Estrogen-induced pituitary tumorigenesis QTL 133.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)177494165122494165Rat
10054135Gmadr2Adrenal mass QTL 21.970.0129adrenal gland mass (VT:0010420)both adrenal glands wet weight (CMO:0000164)177857876122857876Rat
1549903Bp267Blood pressure QTL 267arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)177876254106047988Rat
61344Bp29Blood pressure QTL 297.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)178350581123350581Rat
7411712Strs4Sensitivity to stroke QTL 48.7cerebrum integrity trait (VT:0010549)percentage of study population developing cerebrovascular lesions during a period of time (CMO:0000932)178430536123430536Rat
61433Cia2Collagen induced arthritis QTL 25joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)17843075491209302Rat
1582234Gluco18Glucose level QTL 183.40.0003blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)178479925123479925Rat
70223Bp57Blood pressure QTL 575arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)10180676123Rat
631554Bp133Blood pressure QTL 1330.005arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)1074336463851208Rat
2313064Bmd71Bone mineral density QTL 710.90.0001tibia mineral mass (VT:1000283)cortical volumetric bone mineral density (CMO:0001730)10538701450387014Rat
2313066Bss63Bone structure and strength QTL 631.40.0001tibia strength trait (VT:1000284)bone polar moment of inertia (CMO:0001558)10538701450387014Rat
2313081Bss64Bone structure and strength QTL 641.30.0001tibia strength trait (VT:1000284)tibia total energy absorbed before break (CMO:0001736)10538701450387014Rat
2313095Bss62Bone structure and strength QTL 621.50.0001tibia size trait (VT:0100001)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
2313104Bss61Bone structure and strength QTL 610.90.0001tibia area (VT:1000281)tibia midshaft cross-sectional area (CMO:0001717)10538701450387014Rat
2298544Neuinf9Neuroinflammation QTL 94.6nervous system integrity trait (VT:0010566)spinal cord complement component 1, q subcomponent, B chain mRNA level (CMO:0002126)10580199062146030Rat
8662860Vetf10Vascular elastic tissue fragility QTL 10artery integrity trait (VT:0010639)number of ruptures of the internal elastic lamina of the abdominal aorta and iliac arteries (CMO:0002562)10615418273453136Rat
61427Cia16Collagen induced arthritis QTL 163.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)10635789696121100Rat
1578761Stresp21Stress response QTL 213.3thymus mass (VT:0004954)thymus wet weight (CMO:0000855)10637574651375746Rat
2303118Mamtr7Mammary tumor resistance QTL 70.003mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)109658275104670812Rat
9590310Scort19Serum corticosterone level QTL 196.30.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9590268Scort13Serum corticosterone level QTL 133.260.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)101147401056474010Rat
9589136Insul27Insulin level QTL 2710.460.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)101147401056474010Rat
2301967Cm73Cardiac mass QTL 734.55heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)101448701189062041Rat
631268Cia21Collagen induced arthritis QTL 213.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1014487011104060283Rat
2316949Gluco60Glucose level QTL 603.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1014487011107057807Rat
1354587Kidm21Kidney mass QTL 213.3kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)101502851360430477Rat
631564Apr3Acute phase response QTL 33.9blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)101527595560275955Rat
6893350Bw99Body weight QTL 990.870.16body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
6893352Bw100Body weight QTL 1000.330.6body mass (VT:0001259)body weight (CMO:0000012)11590666560906665Rat
631532Cm50Cardiac mass QTL 506.6heart mass (VT:0007028)calculated heart weight (CMO:0000073)101790711351786432Rat
1598852Anxrr19Anxiety related response QTL 195.07body movement coordination trait (VT:0005424)number of rearing movements in an experimental apparatus (CMO:0001752)101816784163167841Rat
2313055Bw96Body weight QTL 963.60.0001body mass (VT:0001259)body weight (CMO:0000012)101960648364606483Rat
2313087Bmd80Bone mineral density QTL 803.20.0001tibia mineral mass (VT:1000283)total volumetric bone mineral density (CMO:0001728)101960648364606483Rat
1554317Bmd4Bone mineral density QTL 49.40.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)101981604299406971Rat
1581497Esta1Estrogen-induced thymic atrophy QTL 1thymus mass (VT:0004954)thymus wet weight (CMO:0000855)102132980561345413Rat
724556Pur2Proteinuria QTL 25.5urine protein amount (VT:0005160)urine protein level (CMO:0000591)102242750090627625Rat
61354Pia10Pristane induced arthritis QTL 100.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
631267Cia20Collagen induced arthritis QTL 203.2joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
61325Aia5Adjuvant induced arthritis QTL 50.01joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1023444813104060283Rat
70224Eae3Experimental allergic encephalomyelitis QTL 34.1nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)102652195761345413Rat
1298069Bp168Blood pressure QTL 1685.5blood pressure trait (VT:0000183)systolic blood pressure (CMO:0000004)102652195798003205Rat
631542Bp82Blood pressure QTL 826.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)102652195798952741Rat
2300171Bmd58Bone mineral density QTL 584.90.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)102694462871944628Rat
10402859Bp381Blood pressure QTL 3810.002arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
2292441Bp308Blood pressure QTL 308arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102760646872606468Rat
724527Bp148Blood pressure QTL 1480.0001arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)102845313673453136Rat
1600371Mcs21Mammary carcinoma susceptibility QTL 213mammary gland integrity trait (VT:0010552)mammary tumor growth rate (CMO:0000344)102887565052200160Rat
1331762Rf40Renal function QTL 403.873kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)102929950464155584Rat
1331791Cm31Cardiac mass QTL 313.84606heart mass (VT:0007028)heart wet weight (CMO:0000069)1029299504107211142Rat
631557Bp136Blood pressure QTL 1360.003arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)103063205375632053Rat
1576311Pia26Pristane induced arthritis QTL 26joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103122402675632053Rat
1578779Tcas10Tongue tumor susceptibility QTL 103.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)103129743976297439Rat
1576319Cia29Collagen induced arthritis QTL 29joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)103397392178973921Rat
1354614Hpcl1Hepatic cholesterol level QTL 13.3liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)103539226751793994Rat
1358897Stresp6Stress response QTL 64.170.022blood norepinephrine amount (VT:0005663)plasma norepinephrine level (CMO:0001010)103539226764155584Rat
61441Btemp1Thermal response to stress QTL 14body temperature trait (VT:0005535)core body temperature (CMO:0001036)103539245763642539Rat
2317042Aia20Adjuvant induced arthritis QTL 203.38joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)103756507982565079Rat
2317043Aia7Adjuvant induced arthritis QTL 73.82joint integrity trait (VT:0010548)left rear ankle joint diameter (CMO:0002149)103756507982565079Rat
1576308Schws1Schwannoma susceptibility QTL 10.0041nervous system integrity trait (VT:0010566)percentage of study population developing trigeminal nerve neurilemmomas during a period of time (CMO:0002017)1040035094102359817Rat
631269Cia22Collagen induced arthritis QTL 228.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631270Cia23Collagen induced arthritis QTL 233.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1040035094104060283Rat
631552Vetf2Vascular elastic tissue fragility QTL 24.50.0002aorta elastic tissue integrity trait (VT:0010556)artery internal elastic lamina non-tumorous lesion count (CMO:0001913)104114263386142633Rat
61463Bp12Blood pressure QTL 126.30.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104133325886333258Rat
8552805Bw145Body weight QTL 1452.2body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)104194452678307017Rat
1298078Stresp5Stress response QTL 52.990.00025blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1042045676104670812Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)14232313287323132Rat
70188BpQTLcluster1Blood pressure QTL cluster 14.864arterial blood pressure trait (VT:2000000)pulse pressure (CMO:0000292)14232313287323132Rat
70198BpQTLcluster9Blood pressure QTL cluster 92.94arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)104232313287323132Rat
6893342Cm78Cardiac mass QTL 780.10.88heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)104287676679813922Rat
9589030Epfw9Epididymal fat weight QTL 919.240.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)104444169989441699Rat
7411614Foco18Food consumption QTL 180.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)104444169989441699Rat
8694173Bw149Body weight QTL 1494.380.001body mass (VT:0001259)body weight gain (CMO:0000420)104444169989441699Rat
2300218Hpcl2Hepatic cholesterol level QTL 2liver cholesterol amount (VT:0010498)liver cholesterol level (CMO:0001597)104502965095600334Rat
631547Bp87Blood pressure QTL 874.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)104736947092369470Rat
731181Uae27Urinary albumin excretion QTL 272.70.0059urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)X143491017Rat
634325Bw13Body weight QTL 130body mass (VT:0001259)body weight (CMO:0000012)X144797220991088Rat
70165Bp64Blood pressure QTL 645.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)X144812931706553Rat
631204Gluco15Glucose level QTL 150.001blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)X162371522646544Rat
1298071Edpm12Estrogen-dependent pituitary mass QTL 123.2pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)X292789847927898Rat
10755455Coatc13Coat color QTL 130coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7440600049406000Rat
631666Iddm5Insulin dependent diabetes mellitus QTL 5blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X449454949494549Rat
61430Cia18Collagen induced arthritis QTL 183.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)X14843113120568734Rat
71116Niddm16Non-insulin dependent diabetes mellitus QTL 167.81blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)X1529780260297802Rat
61410Bw19Body weight QTL 196.20.001body mass (VT:0001259)body weight (CMO:0000012)7144782185Rat
631503Bp102Blood pressure QTL 1021.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)7144822433Rat
634336Anxrr17Anxiety related response QTL 173.66locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)7924703115097879Rat
10755438Coatc9Coat color QTL 90coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7352928048529280Rat
9590102Sffal5Serum free fatty acids level QTL 58.620.001blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)7532901950329019Rat
10755440Coatc10Coat color QTL 100coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)7749649952496499Rat
10059592Kidm45Kidney mass QTL 453.950.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)7757398552573985Rat
2298547Neuinf5Neuroinflammation QTL 53.7nervous system integrity trait (VT:0010566)spinal cord Cd74 protein level (CMO:0002131)7946224658265113Rat
1643004Pain2Pain QTL 21mechanical nociception trait (VT:0002734)self mutilation severity score (CMO:0002145)7946224698011544Rat
1578652Bmd15Bone mineral density QTL 155.2femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)7986646760460686Rat
738033Anxrr6Anxiety related response QTL 64.1exploratory behavior trait (VT:0010471)percentage of entries into a discrete space in an experimental apparatus (CMO:0000961)71557388960573889Rat
2317059Aia15Adjuvant induced arthritis QTL 152.46joint integrity trait (VT:0010548)right rear ankle joint diameter (CMO:0002150)71700459862004598Rat
10755451Coatc11Coat color QTL 110coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)71794435762944357Rat
1354637Scl30Serum cholesterol level QTL 303.7blood cholesterol amount (VT:0000180)blood total cholesterol level (CMO:0000051)71965431749753746Rat
1354644Spl4Serum phospholipid level QTL 44.9blood phospholipid amount (VT:0006084)blood phospholipid level (CMO:0001169)71965431749753746Rat
1354639Spl5Serum phospholipid level QTL 53.9blood LDL phospholipid amount (VT:0010505)blood low density lipoprotein phospholipid level (CMO:0001568)71965431752888450Rat
1300132Bp182Blood pressure QTL 1823.49arterial blood pressure trait (VT:2000000)blood pressure time series experimental set point of the baroreceptor response (CMO:0002593)71965431784928080Rat
7411569Bw137Body weight QTL 1370.001body mass (VT:0001259)body weight gain (CMO:0000420)72192119566921195Rat
1641885Alcrsp9Alcohol response QTL 9alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)72409960669099606Rat
1549840Bss5Bone structure and strength QTL 59.8femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)72475184169751841Rat
70190Mcs6Mammary carcinoma susceptibility QTL 62.29mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)72673740163902784Rat
1300138Hrtrt9Heart rate QTL 94.72heart pumping trait (VT:2000009)heart rate (CMO:0000002)72940968353612950Rat
10402855Bp379Blood pressure QTL 3790.21arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)72940968374409683Rat
1300127Srn1Serum renin concentration QTL 13.87blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)72940968384928080Rat
10755453Coatc12Coat color QTL 120coat/hair pigmentation trait (VT:0010463)pigmented ventral coat/hair area to total ventral coat/hair area ratio (CMO:0001812)73111283276112832Rat
7411605Foco14Food consumption QTL 1424.10.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)73429328279293282Rat
631534Lnnr1Liver neoplastic nodule remodeling QTL 13.850.001liver integrity trait (VT:0010547)liver remodeling tumorous lesion number to liver total tumorous lesion number ratio (CMO:0001705)73429328279293282Rat
631513Scl7Serum cholesterol level QTL 74.1blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)73796056982960569Rat
70212Niddm25Non-insulin dependent diabetes mellitus QTL 253.54blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)51131345958Rat
1576314Eutr1Estrogen induced uterine response QTL 1uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)52138965166875058Rat
634305Mamtr1Mammary tumor resistance QTL 10.0001mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)512789751113558310Rat
2290448Scl54Serum cholesterol level QTL 542.93blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)531663789131345958Rat
1576317Eutr2Estrogen induced uterine response QTL 20.01uterus integrity trait (VT:0010575)pyometritis severity score (CMO:0002009)534730116104251008Rat
2316959Gluco59Glucose level QTL 594.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)534944474113558310Rat
1641912Alcrsp18Alcohol response QTL 18response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)535189153141643988Rat
1549845Scl44Serum cholesterol level QTL 446blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)540128307148607290Rat
1331801Rf33Renal function QTL 334.149kidney blood vessel physiology trait (VT:0100012)absolute change in renal vascular resistance (CMO:0001900)543726656129132602Rat
1578766Tcas11Tongue tumor susceptibility QTL 114.12tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)546711509161317411Rat
1576312Emca8Estrogen-induced mammary cancer QTL 84.1mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)550328551141643988Rat
70189Mcs5Mammary carcinoma susceptibility QTL 510.51mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)555805606132207589Rat
1358895Bp254Blood pressure QTL 2543.60.0003arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)558829236128034027Rat
61426Scl2Serum cholesterol level QTL 27.30.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)559793399143070159Rat
2316957Pur21Proteinuria QTL 216.2urine protein amount (VT:0005160)urine protein level (CMO:0000591)559793528113558156Rat
61393Bp7Blood pressure QTL 74.50.0001arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)560293434161481680Rat
2290005Mcs24Mammary carcinoma susceptibility QTL 24mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)564719390109719390Rat
2306971Anxrr21Anxiety related response QTL 219.47fear/anxiety-related behavior trait (VT:1000241)number of entries into a discrete space in an experimental apparatus (CMO:0000960)566174080124160948Rat
2312671Scl64Serum cholesterol level QTL 640.001blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)568984307104251008Rat
61380Edpm5Estrogen-dependent pituitary mass QTL 54.50.92pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)568984307104251008Rat
1357396Bw44Body weight QTL 444.19body mass (VT:0001259)body weight (CMO:0000012)568984307104251008Rat
1357402Bw46Body weight QTL 464.47body mass (VT:0001259)body mass index (BMI) (CMO:0000105)568984307104251008Rat
2302381Bw84Body weight QTL 844.47body mass (VT:0001259)body mass index (BMI) (CMO:0000105)568984307104251008Rat
1354598Srn6Serum renin concentration QTL 63.8blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)569540295151018848Rat
1298070Scl18Serum cholesterol level QTL 183.7blood LDL cholesterol amount (VT:0000181)calculated plasma low density lipoprotein cholesterol level (CMO:0001245)579584860124584860Rat
1598846Bp293Blood pressure QTL 2933.9arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)579584860124584860Rat
1598859Cm66Cardiac mass QTL 662heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)579584860124584860Rat
1302790Scl20Serum cholesterol level QTL 206.40.0001blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)582394392166664054Rat
1298086Bp156Blood pressure QTL 156arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)584132602129132602Rat
7411601Foco12Food consumption QTL 1219.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
7411564Bw135Body weight QTL 1350.001body mass (VT:0001259)body weight gain (CMO:0000420)587468046132468046Rat
7411582Foco3Food consumption QTL 37.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)587468046132468046Rat
6903316Bw113Body weight QTL 11320.0103body mass (VT:0001259)body weight (CMO:0000012)587765973132765973Rat
1358889Bp261Blood pressure QTL 2612.86arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)590067849128034027Rat
1358909Kidm25Kidney mass QTL 251.87kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)590067849128034027Rat
631527Tls1T-lymphoma susceptibility QTL 100.001thymus integrity trait (VT:0010555)post-insult time to onset of T-cell lymphoma (CMO:0001907)590450144135450144Rat
61452Ciaa5CIA Autoantibody QTL 53.5blood autoantibody amount (VT:0003725)calculated serum anti-rat type 2 collagen autoantibody titer (CMO:0001281)594858972143070159Rat
1331796Thshl2Thyroid stimulating hormone level QTL 22.3blood thyroid-stimulating hormone amount (VT:0005119)serum thyroid stimulating hormone level (CMO:0001248)597059760147465714Rat
2317753Glom24Glomerulus QTL 243.1kidney glomerulus integrity trait (VT:0010546)kidney sclerotic glomeruli count to total glomeruli count ratio (CMO:0001269)597570330136479578Rat
1582212Livw2Liver weight QTL 23.50.0004liver mass (VT:0003402)liver weight to body weight ratio (CMO:0000633)599016066119085810Rat
1358187Emca1Estrogen-induced mammary cancer QTL 14.4mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)599216724148607142Rat
7394708Emca11Estrogen-induced mammary cancer QTL 11mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)599753548113061097Rat
1578673Bmd13Bone mineral density QTL 134.9femur mineral mass (VT:0010011)trabecular volumetric bone mineral density (CMO:0001729)5103689353148689353Rat


Additional Information

Database Acc Id Source(s)
UniSTS 122612 UniSTS