D8Rat68 Marker Search Result - Rat Genome Database

General

Marker: D8Rat68

Symbol:

D8Rat68

Previously known as:

R0060-D07; oxsts7469;

RGD ID:

37712

Expected Size:

194 (bp)

Position

Rat Assembly	Chr	Position (strand)	Source	JBrowse
mRatBN7.2	8	18,984,168 - 18,984,364 (+)	MAPPER	mRatBN7.2
Rnor_6.0	8	21,464,919 - 21,465,112	NCBI	Rnor6.0
Rnor_5.0	8	21,522,570 - 21,522,763	UniSTS	Rnor5.0
RGSC_v3.4	8	19,460,544 - 19,460,738	RGD	RGSC3.4
RGSC_v3.4	8	19,460,545 - 19,460,738	UniSTS	RGSC3.4
RGSC_v3.1	8	19,460,544 - 19,460,738	RGD
Celera	8	20,379,486 - 20,379,679	UniSTS
SHRSP x BN Map	8	12.9	UniSTS
SHRSP x BN Map	8	12.9	RGD
Cytogenetic Map	8	q13	UniSTS

Is Marker For:

Strains: AVN/Orl BBDP/Rhw BBDR/Rhw BC/CpbU BDIX/Han BDVII/Cub BN/SsNHsd BP/Cub DA/PitN DON/Melb FHH/Eur IS/Kyo LE/Mol LEW/Pit LH/Mav MHS/Gib MNRA/N WN/N WKY/OlaHsd WTC/Kyo LOU/CHan MNR/N MR/Pit ODU/N WF/Pit OKA/Wsl OM/Ztm PVG/Pit SD/Rij SHR/OlaHsd WAG/RijKyo M520/N ACI/N BN-Lx/Cub LN/Mav GH/Omr SS/Jr COP/OlaHsd
QTLs: Lecl1
Genes: Zfp26

Annotation

References - curated

#	Reference Title	Reference Citation
1.	Data downloaded from Wellcome Trust, University of Oxford	Data downloaded from Wellcome Trust, University of Oxford
2.	Rat Genetic Map Data	Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
3.	Electronic Transfer of SSLP Data	Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
4.	UniSTS Pipeline	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	ACGGGGATCTAATCTGGCTT
Reverse Primer	GGTACTTGCAGTTATGTGGCAA

Template	CCTTGTGGGAATGGGGAGACCAGAGGCTCTAGGTACTTGCAGTTATGTGGCAAACACACACACA CACACACACACACACACACACACACACACACACACCCCAAACACACAATTGAATAAATAAATGG AACTCTCTTAAGGAATGAATGAGGCTTTATTTGATATATTATTATATTATTTCTCCACCTGTGA AATGAGCCAATTCAAGCCAGATTAGATCCCCGTAAGTGGAGTTACAGATTTTCATGAGGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAAT TCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAA CTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGC ATTAATGAATCGGCCACGCGCGGGGAGANGCGGTTTGCGTATTGGGCGCCAGGGTGGTTNTTCT TTTCACAGTGAGAGGGAAAGTGATTGCCTTCACGCCTGCCCTGAGAGAGTGCACAACGGTCACT GGTTGC

Strain Variation

Strain, Expected Size(s)

ACI/N	192
AVN/Orl	176
BBDP/Rhw	194
BBDR/Rhw	192
BC/CpbU	176
BDIX/Han	176
BDVII/Cub	176
BN-Lx/Cub	192
BN/SsNHsd	192
BP/Cub	192

COP/OlaHsd	176
DA/PitN	192
DON/Melb	192
FHH/Eur	192
GH/Omr	192
IS/Kyo	180
LE/Mol	192
LEW/Pit	192
LH/Mav	192
LN/Mav	192

LOU/CHan	196
M520/N	192
MHS/Gib	192
MNR/N	192
MNRA/N	192
MR/Pit	192
ODU/N	192
OKA/Wsl	176
OM/Ztm	176
PVG/Pit	176

SD/Rij	192
SHR/OlaHsd	176
SS/Jr	192
WAG/RijKyo	192
WF/Pit	192
WKY/OlaHsd	192
WN/N	192
WTC/Kyo	192

Region

Genes in Region

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1565847	Zfp26	zinc finger protein 26	8	18959656	18985647	Rat

Nucleotide Sequences


GenBank Nucleotide	CH473993	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	CM000238	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (mRatBN7.2)

The following QTLs overlap with this region.

RGD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
9590084	Insglur5	Insulin/glucose ratio QTL 5	18.54	0.001	blood insulin amount (VT:0001560)	calculated plasma insulin level (CMO:0002170)	8	1	24597739	Rat
2317882	Alcrsp24	Alcohol response QTL 24	3.2	0.05	response to alcohol trait (VT:0010489)	duration of loss of righting reflex (CMO:0002289)	8	1	25902202	Rat
12880023	Bw184	Body weight QTL 184		0.001	body mass (VT:0001259)	body weight (CMO:0000012)	8	2097640	47097640	Rat
12880025	Cm102	Cardiac mass QTL 102		0.044	heart mass (VT:0007028)	heart wet weight to body weight ratio (CMO:0002408)	8	2097640	47097640	Rat
12880028	Cm103	Cardiac mass QTL 103		0.02	heart left ventricle mass (VT:0007031)	heart left ventricle weight to body weight ratio (CMO:0000530)	8	2097640	47097640	Rat
12880044	Am9	Aortic mass QTL 9		0.007	aorta mass (VT:0002845)	aorta weight to aorta length to body weight ratio (CMO:0002722)	8	2097640	47097640	Rat
2317032	Ginf2	Gastrointestinal inflammation QTL 2	3.21	0.005	liver integrity trait (VT:0010547)	liver granuloma severity score (CMO:0002157)	8	4705810	49705810	Rat
2317036	Livw3	Liver weight QTL 3	2.43	0.01	liver mass (VT:0003402)	liver weight to body weight ratio (CMO:0000633)	8	4705810	49705810	Rat
2317048	Ginf1	Gastrointestinal inflammation QTL 1	3.52	0.005	cecum mucosa thickness (VT:0010234)	enterocolitis severity score (CMO:0002138)	8	4705810	49705810	Rat
2301416	Bp315	Blood pressure QTL 315		0.008	arterial blood pressure trait (VT:2000000)	mean arterial blood pressure (CMO:0000009)	8	7670578	52670578	Rat
1354595	Despr4	Despair related QTL 4	2.16	0.0036	locomotor behavior trait (VT:0001392)	amount of time spent in voluntary immobility (CMO:0001043)	8	7688955	52688955	Rat
1354627	Despr14	Despair related QTL 14		0.0056	locomotor behavior trait (VT:0001392)	amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)	8	7688955	52688955	Rat
1581557	Eae16	Experimental allergic encephalomyelitis QTL 16	3.8		nervous system integrity trait (VT:0010566)	experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)	8	8462195	110921472	Rat
2317030	Wbc5	White blood cell count QTL 5	3.21	0.005	leukocyte quantity (VT:0000217)	white blood cell count (CMO:0000027)	8	8736635	53736635	Rat
2317051	Aia18	Adjuvant induced arthritis QTL 18	2.42		joint integrity trait (VT:0010548)	left rear ankle joint diameter (CMO:0002149)	8	8736635	53736635	Rat
1598824	Memor4	Memory QTL 4	2.5		exploratory behavior trait (VT:0010471)	total horizontal distance resulting from voluntary locomotion in an experimental apparatus (CMO:0001443)	8	9712220	53356647	Rat
1357398	Slep3	Serum leptin concentration QTL 3	3.43		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	8	9712463	41866876	Rat
2302367	Slep5	Serum leptin concentration QTL 5	3.43		blood leptin amount (VT:0005667)	serum leptin level (CMO:0000780)	8	9712463	41866876	Rat
631650	Stl6	Serum triglyceride level QTL 6	4	0.0019	blood triglyceride amount (VT:0002644)	plasma triglyceride level (CMO:0000548)	8	10378157	112202585	Rat
1558646	Swd5	Spike wave discharge measurement QTL 5	3.45	0.00036	brain electrophysiology trait (VT:0010557)	brain spike-and-wave discharge frequency (CMO:0001742)	8	14906751	59906751	Rat
61373	Mcs4	Mammary carcinoma susceptibility QTL 4	1.1		mammary gland integrity trait (VT:0010552)	mammary tumor number (CMO:0000343)	8	16290444	61290444	Rat
631271	Lecl1	Lens clarity QTL 1		0.001	lens clarity trait (VT:0001304)	age of onset/diagnosis of cataract (CMO:0001584)	8	18984168	84531599	Rat

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	367033	UniSTS
UniSTS	119128	UniSTS

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Create Name:

Description:

Send us a Message

Marker: D8Rat68