D14Rat42 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D14Rat42

Symbol: D14Rat42
Also known as: R0052-C06; oxsts9566; 
RGD ID: 37350
Expected Size: 242 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01414,444,994 - 14,445,241NCBIRnor6.0
Rnor_5.01414,386,719 - 14,386,966UniSTSRnor5.0
RGSC_v3.41414,315,728 - 14,315,976RGDRGSC3.4
RGSC_v3.41414,315,729 - 14,315,976UniSTSRGSC3.4
RGSC_v3.11414,315,710 - 14,316,035RGD
Celera1412,857,606 - 12,857,845UniSTS
Cytogenetic Map14p22UniSTS
SHRSP x BN Map146.9UniSTS
SHRSP x BN Map146.9RGD
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   NEDH/K   SS/Jr   COP/OlaHsd  
Genes:   Fras1  


Annotation



Strains and Sequence

Sequence
 
Forward Primer TTCTTTCCAACTCTCTGTTGTATCA
Reverse Primer TGTTTCCAGTTTCTCCCTGC
 
Template
TTTCCCTTAGAATCCCTGGTTTGTTTTATGATTGTGTTTCATGTTGCTGTCTAACGGCTTTCTT
TGTTTCCAGTTTCTCCCTGCTTTTTTAGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTTTATATGCATATATTCATGTGTGCGTGTGGGCATTTGTGCACACCAGAGTAATCAAT
CCGAGTACTTTCTTCTATCACTCCTCTACCTTTTCTTTAATTTTTTCAAACAACATATGAATAG
TTATACACANATATGTGTATATATTTGATACAACAGAGAGTTGGAAAGAAACTAACATCAACCT
CTGGTACGNAGCTCGAATTCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTANCCGC
TCACAATTCCAC

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1306516Fras1Fraser extracellular matrix complex subunit 1141443839214853016Rat

Nucleotide Sequences
GenBank Nucleotide CH474022 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
2300159Bmd61Bone mineral density QTL 615.30.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
2300183Bmd60Bone mineral density QTL 605.70.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)14127597761Rat
619619Rf4Renal disease susceptibility QTL 44.10.002total urine protein amount (VT:0000032)urine protein excretion rate to body weight ratio (CMO:0001099)14134403399Rat
9589814Gluco67Glucose level QTL 674.540.001blood glucose amount (VT:0000188)plasma glucose level (CMO:0000042)14141333960Rat
7411573Bw139Body weight QTL 1394.70.001body mass (VT:0001259)body weight gain (CMO:0000420)14141333960Rat
634352Apr6Acute phase response QTL 63.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)14142766285Rat
70204Niddm20Non-insulin dependent diabetes mellitus QTL 205.10.000008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)14222782519230541Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)14483323319909932Rat
2293089Iddm31Insulin dependent diabetes mellitus QTL 314.7blood glucose amount (VT:0000188)age at onset/diagnosis of type 1 diabetes mellitus (CMO:0001140)14483323319909932Rat
1300114Srn2Serum renin concentration QTL 23.27blood renin amount (VT:0003349)plasma renin activity level (CMO:0000116)14483323323004027Rat
70195Mcs8Mammary carcinoma susceptibility QTL 84.28mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)14483323326466248Rat
1331740Bw26Body weight QTL 263.028body mass (VT:0001259)body weight (CMO:0000012)14483323333040042Rat
1581500Renag1Renal agenesis QTL 1kidney development trait (VT:0000527)percentage of study population developing unilateral renal agenesis during a period of time (CMO:0000940)14975643572854397Rat
1358296Ael3Aortic elastin QTL 33.70.00051aorta elastin amount (VT:0003905)aortic elastin141053997755539977Rat
2302045Pia39Pristane induced arthritis QTL 394.90.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G2a level (CMO:0002116)141053997755539977Rat
731183Pia20Pristane induced arthritis QTL 203.55joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)141072926861873323Rat
2302277Gluco38Glucose level QTL 385.8blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)141268042430155192Rat
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1412680424106641756Rat
631212Bw5Body weight QTL55.43retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)141268061332593926Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 289486 UniSTS
UniSTS 226649 UniSTS