D7Rat24 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D7Rat24

Symbol: D7Rat24
Also known as: R0044-A07; oxsts7349; R044-A07; 
RGD ID: 36731
Expected Size: 154 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Celera766,281,598 - 66,281,749UniSTS
RH 3.4 Map7638.8RGD
RH 3.4 Map7638.8UniSTS
SHRSP x BN Map744.39UniSTS
SHRSP x BN Map744.39RGD
FHH x ACI Map734.52RGD
Cytogenetic Map7q22UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Sradr5   Gluco53   Aia16  
Genes:   Ubr5  


Annotation



Strains and Sequence

Sequence
 
Forward Primer CATAATCAGAGCAAGCCAAGG
Reverse Primer TGTGTCAGAGAAAAATGGCAG
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473950 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000237 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 100303149 UniSTS
  100303434 UniSTS
  100381222 UniSTS
  117060 UniSTS
UniSTS 228183 UniSTS