D1Rat55 Marker Search Result - Rat Genome Database

Send us a Message



Submit Data |  Help |  Video Tutorials |  News |  Publications |  Download |  REST API |  Citing RGD |  Contact   

Marker: D1Rat55

Symbol: D1Rat55
Previously known as: R0043-B02; oxsts6716; R043-B02; 
RGD ID: 36566
Expected Size: 142 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_5.01184,481,328 - 184,481,458NCBIRnor5.0
Rnor_5.01184,481,327 - 184,481,458NCBIRnor5.0
RGSC_v3.41170,489,842 - 170,489,972RGDRGSC3.4
RGSC_v3.41170,489,843 - 170,489,972UniSTSRGSC3.4
RGSC_v3.11170,609,777 - 170,609,906RGD
Celera1164,672,382 - 164,672,511UniSTS
RH 3.4 Map11322.3UniSTS
RH 3.4 Map11322.3RGD
RH 2.0 Map1854.0RGD
SHRSP x BN Map183.52RGD
FHH x ACI Map180.0199RGD
Cytogenetic Map1q34UniSTS
Is Marker For: Strains:   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BUF/Pit   DON/Melb   IS/Kyo   LEW/Pit   MHS/Gib   MNRA/N   WN/N   WTC/Kyo   LOU/CHan   MR/Pit   WIST/Nhg   SR/Jr   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SHR/OlaHsd   WAG/RijKyo   GK/KyoSwe   GH/Omr   COP/OlaHsd   SS/Jr   BDVII/Cub   BN/SsNHsd   BP/Cub   DA/PitN   F344/Pit   FHH/Eur   LH/Mav   WKY/OlaHsd   MNR/N   ODU/N   WF/Pit   MNS/Gib   SD/Rij   SHRSP/Riv   M520/N   BN-Lx/Cub   LN/Mav   NEDH/K  
QTLs:   Bp77  
Genes:   Tead1  


Annotation


References - curated
# Reference Title Reference Citation
1. Data downloaded from Wellcome Trust, University of Oxford Data downloaded from Wellcome Trust, University of Oxford
2. High-density rat radiation hybrid maps containing over 24,000 SSLPs, genes, and ESTs provide a direct link to the rat genome sequence. Kwitek AE, etal., Genome Res. 2004 Apr;14(4):750-7
3. Rat Genetic Map Data Rat Genetic Map Data, Whitehead Institute for Biomedical Research/MIT Center for Genome Research Website, http://waldo.wi.mit.edu/rat/public/distribution/rat_sslp_releases/jan00/
4. Electronic Transfer of SSLP Data Rat Genetic Mapping Project, Whitehead Institute for Biomedical Research. APR. 2001.
5. UniSTS Pipeline RGD automated pipelines
6. RH Map Project RH Map Project, Laboratory of Genetic Research Website, 1-JUL-99, Laboratory of Genetic Research, Medical College of Wisconsin, http://www.lgr.mcw.edu/LGR/
7. A high density integrated genetic linkage and radiation hybrid map of the laboratory rat Steen RG, Kwitek-Black AE, etal., Genome Research, 1999, 6:1-8

Strains and Sequence

Sequence
 
Forward Primer ATACATCCCCAGCCAACTTG
Reverse Primer TCATGTGGAAGATCAAGCCA
 

Region

Nucleotide Sequences
GenBank Nucleotide CH473956 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  CM000231 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


Additional Information

Database Acc Id Source(s)
NCBI Gene 326567 UniSTS
  361630 UniSTS
UniSTS 118596 UniSTS