D12Mit10 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D12Mit10

Symbol: D12Mit10
Also known as: oxsts8845; 
RGD ID: 36344
Expected Size: 121 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0617,904,604 - 17,904,724NCBIRnor6.0
Rnor_6.01226,670,797 - 26,670,921NCBIRnor6.0
Rnor_5.0627,809,905 - 27,810,025UniSTSRnor5.0
Rnor_5.01228,661,333 - 28,661,457UniSTSRnor5.0
RGSC_v3.41224,709,376 - 24,709,500UniSTSRGSC3.4
RGSC_v3.4617,042,362 - 17,042,482UniSTSRGSC3.4
RGSC_v3.11224,572,591 - 24,572,716RGD
Celera1225,379,804 - 25,379,928UniSTS
Celera61,392,222 - 1,392,354UniSTS
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  


Annotation


References - curated
1. Data downloaded from Wellcome Trust, University of Oxford
2. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GTGTTTATTGGCCAGCTAGTC
Reverse Primer TGCAAGAGCAATGAGTTATTAA
 

Region



QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
RGD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1598843Cm63Cardiac mass QTL 632.6heart mass (VT:0007028)heart weight to body weight ratio (CMO:0000074)6123620518Rat
1578758Tcas9Tongue tumor susceptibility QTL 93.29tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)6125048718Rat
738023Alc17Alcohol consumption QTL 173.10.003consumption behavior trait (VT:0002069)ethanol drink intake rate to body weight ratio (CMO:0001616)6135623029Rat
1354616Despr12Despair related QTL 120.0012locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)6135623029Rat
1549905Stresp10Stress response QTL 106.830.0066stress-related behavior trait (VT:0010451)number of approaches toward negative stimulus before onset of defensive burying response (CMO:0001960)6135623029Rat
2300176Bmd51Bone mineral density QTL 5111.70.0001femur mineral mass (VT:0010011)bone mineral density (CMO:0001226)6135623029Rat
2300190Bmd52Bone mineral density QTL 5211.20.0001femur mineral mass (VT:0010011)volumetric bone mineral density (CMO:0001553)6135623029Rat
1331743Uae28Urinary albumin excretion QTL 284.5urine albumin amount (VT:0002871)urine albumin level (CMO:0000130)6141917988Rat
9589048Scfw3Subcutaneous fat weight QTL 34.570.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)6142388212Rat
9589129Insul24Insulin level QTL 2419.060.001blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)6142388212Rat
7411603Foco13Food consumption QTL 135.50.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6142388212Rat
7411542Bw127Body weight QTL 1275.50.001body mass (VT:0001259)body weight gain (CMO:0000420)6142388212Rat
8552962Pigfal16Plasma insulin-like growth factor 1 level QTL 169.4blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)6142388212Rat
2293709Bss23Bone structure and strength QTL 235.180.0001femur morphology trait (VT:0000559)femur cross-sectional area (CMO:0001661)6143665660Rat
2293650Bss31Bone structure and strength QTL 315.050.0001femur strength trait (VT:0010010)femur midshaft polar moment of inertia (CMO:0001669)6143665660Rat
2293656Bss28Bone structure and strength QTL 286.790.0001femur morphology trait (VT:0000559)femur midshaft cortical cross-sectional area (CMO:0001663)6143665660Rat
7411584Foco4Food consumption QTL 44.30.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)6144015370Rat
738024Sach5Saccharine consumption QTL 53.90.00039consumption behavior trait (VT:0002069)saccharin intake volume to total fluid intake volume ratio (CMO:0001601)6144570292Rat
2301972Bp325Blood pressure QTL 3254.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)6175623393Rat
8693645Alc31Alcohol consumption QTL 313.70.038drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)613505323600274Rat
1359023Bp272Blood pressure QTL 2722.5arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)6112039328706721Rat
2292589Emca10Estrogen-induced mammary cancer QTL 100.048mammary gland integrity trait (VT:0010552)post-insult time to mammary tumor formation (CMO:0000345)6112039346120393Rat
1354664Slep2Serum leptin concentration QTL 24.49blood leptin amount (VT:0005667)serum leptin level (CMO:0000780)6112039375023446Rat
1576309Emca7Estrogen-induced mammary cancer QTL 74mammary gland integrity trait (VT:0010552)mammary tumor number (CMO:0000343)62537030111715717Rat
1578665Bss16Bone structure and strength QTL 164.4femur morphology trait (VT:0000559)bone trabecular cross-sectional area (CMO:0002311)6616172276002731Rat
1578668Bmd14Bone mineral density QTL 143.8femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)6616172276002731Rat
4145119Mcs25Mammary carcinoma susceptibility QTL 250.0001mammary gland integrity trait (VT:0010552)ratio of deaths to total study population during a period of time (CMO:0001023)67009971115379601Rat
1358190Ept1Estrogen-induced pituitary tumorigenesis QTL 14.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6808322221515439Rat
2292616Ept15Estrogen-induced pituitary tumorigenesis QTL 154.4pituitary gland mass (VT:0010496)pituitary gland wet weight (CMO:0000853)6808322221515439Rat
8693699Alc37Alcohol consumption QTL 372.60.224drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)6997427722477622Rat
8693690Alc35Alcohol consumption QTL 352.20.606drinking behavior trait (VT:0001422)calculated ethanol drink intake rate (CMO:0001615)6997427722477622Rat
634322Bw12Body weight QTL 120body mass (VT:0001259)body weight (CMO:0000012)71017386255173862Rat
2293706Bmd20Bone mineral density QTL 204.30.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)61312295821165729Rat
1300128Rf16Renal function QTL 163.89renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)61312295834367603Rat
1300164Rf15Renal function QTL 153.12renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)61312295857516539Rat
10401812Kidm54Kidney mass QTL 54kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
10401800Kidm49Kidney mass QTL 49kidney mass (VT:0002707)both kidneys wet weight (CMO:0000085)61681010761810107Rat
1581516Cm56Cardiac mass QTL 564.20.05heart left ventricle mass (VT:0007031)heart left ventricle weight to body weight ratio (CMO:0000530)12130749723Rat
1598855Bp294Blood pressure QTL 2943.5arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)12136919844Rat
7387292Kidm42Kidney mass QTL 423.030.0004kidney mass (VT:0002707)left kidney wet weight (CMO:0000083)12138334225Rat
9590086Insglur6Insulin/glucose ratio QTL 618.970.001blood insulin amount (VT:0001560)calculated plasma insulin level (CMO:0002170)1215081045150810Rat
9590147Scort7Serum corticosterone level QTL 713.610.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)1215081045150810Rat
7411545Bw128Body weight QTL 1285.20.001body mass (VT:0001259)body weight gain (CMO:0000420)1215081045150810Rat
7411586Foco5Food consumption QTL 55.40.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)1215081045150810Rat
7411660Foco28Food consumption QTL 2810.90.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)1215081045150810Rat
7411595Foco9Food consumption QTL 940.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)1215081045150810Rat
8694179Bw150Body weight QTL 1502.90.001body mass (VT:0001259)body weight gain (CMO:0000420)1215081045150810Rat
2303575Insul14Insulin level QTL 144blood insulin amount (VT:0001560)blood insulin level (CMO:0000349)1249257845492578Rat
737979Pia22Pristane induced arthritis QTL 2253.1joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)12247568747475687Rat
634351Apr5Acute phase response QTL 56.7blood interleukin-6 amount (VT:0008595)plasma interleukin-6 level (CMO:0001927)12251344247513442Rat
2302042Pia38Pristane induced arthritis QTL 383.50.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)12251344247513442Rat
634350Apr4Acute phase response QTL 46orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)12421005149210051Rat
1302792Scl21Serum cholesterol level QTL 213.80.0011blood cholesterol amount (VT:0000180)plasma total cholesterol level (CMO:0000585)12895459327911196Rat
7411547Bw129Body weight QTL 1290.001body mass (VT:0001259)body weight gain (CMO:0000420)6922362652716770Rat
7411588Foco6Food consumption QTL 60.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12922362652716770Rat
7411597Foco10Food consumption QTL 100.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12922362652716770Rat
7411641Foco19Food consumption QTL 1927.70.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)12922362652716770Rat
8552918Pigfal7Plasma insulin-like growth factor 1 level QTL 7blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12922362652716770Rat
8552964Pigfal17Plasma insulin-like growth factor 1 level QTL 173.5blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12922362652716770Rat
8552912Pigfal6Plasma insulin-like growth factor 1 level QTL 65blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)12922363052716770Rat
10059594Kidm46Kidney mass QTL 463.790.025kidney mass (VT:0002707)both kidneys wet weight to body weight ratio (CMO:0000340)12978983452716770Rat
2293086Iddm30Insulin dependent diabetes mellitus QTL 303.82blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121017588931975590Rat
61331Eau2Experimental allergic uveoretinitis QTL 20.0005uvea integrity trait (VT:0010551)experimental autoimmune uveitis score (CMO:0001504)121025689031723732Rat
1300157Rf21Renal function QTL 214.4renal blood flow trait (VT:2000006)absolute change in renal blood flow rate (CMO:0001168)121176499537522089Rat
1331786Kidm11Kidney mass QTL 113.571kidney mass (VT:0002707)right kidney wet weight (CMO:0000082)121312721127285590Rat
1331755Bp219Blood pressure QTL 2193.041arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121312721131723688Rat
1331761Bp218Blood pressure QTL 2182.973arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)121312721150320041Rat
61404Bw120Body weight QTL 1205.1body mass (VT:0001259)body mass index (BMI) (CMO:0000105)121441977552716770Rat
1549829Scl48Serum cholesterol level QTL 485blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)121502198652716770Rat
61416Pia4Pristane induced arthritis QTL 48.4joint integrity trait (VT:0010548)arthritic paw count (CMO:0001460)121571460935964508Rat
61421Cia12Collagen induced arthritis QTL 124.6joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)121571460941291738Rat
2300186Bmd59Bone mineral density QTL 597.10.0001lumbar vertebra mineral mass (VT:0010511)volumetric bone mineral density (CMO:0001553)121590890052716770Rat
2293699Bss49Bone structure and strength QTL 495.610.0001lumbar vertebra size trait (VT:0010518)lumbar vertebra trabecular cross-sectional area (CMO:0001692)121590890052716770Rat
631543Bp83Blood pressure QTL 835.8arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121718558044098244Rat
2293684Bmd26Bone mineral density QTL 264.40.0002femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)121796086538409001Rat
1641928Alcrsp5Alcohol response QTL 5response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)121834247752716770Rat
2303569Gluco44Glucose level QTL 442blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)121834247752716770Rat
2302060Pia37Pristane induced arthritis QTL 376.10.001blood immunoglobulin amount (VT:0002460)serum immunoglobulin G1 level (CMO:0002115)121872904352716770Rat
1549902Bp269Blood pressure QTL 269arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)121875259352716770Rat
1549912Bp268Blood pressure QTL 268arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)101875259352716770Rat
2306789Ean6Experimental allergic neuritis QTL 64.9nervous system integrity trait (VT:0010566)experimental autoimmune neuritis severity score (CMO:0001528)122265070227190240Rat
737822Alc10Alcohol consumption QTL 102.2consumption behavior trait (VT:0002069)ethanol drink intake rate (CMO:0001407)122265070245946937Rat
5684888Pia42Pristane induced arthritis QTL 42joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)122265070248598906Rat
61324Eae5Experimental allergic encephalomyelitis QTL 514nervous system integrity trait (VT:0010566)percentage of study population developing relapsing-remitting experimental autoimmune encephalomyelitis during a period of time (CMO:0001402)122265070252716770Rat
1298081Cia25Collagen induced arthritis QTL 254.7joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)122265072141291738Rat
70213Niddm27Non-insulin dependent diabetes mellitus QTL 273.72blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)122287629743799153Rat
631521Pia12Pristane induced arthritis QTL 128.9joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)122324124626710128Rat
631560Apr1Acute phase response QTL 16.1orosomucoid 1 amount (VT:0010541)plasma orosomucoid 1 level (CMO:0001467)122490659052716770Rat
7411643Foco20Food consumption QTL 200.001eating behavior trait (VT:0001431)feed conversion ratio (CMO:0001312)122609884552716770Rat


Additional Information

Database Acc Id Source(s)
UniSTS 239269 UniSTS